Incidental Mutation 'R6717:Pdc'
ID529411
Institutional Source Beutler Lab
Gene Symbol Pdc
Ensembl Gene ENSMUSG00000006007
Gene Namephosducin
SynonymsPdc, Rpr1, Rpr-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location150319417-150333906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150333018 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 84 (D84G)
Ref Sequence ENSEMBL: ENSMUSP00000141136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165062] [ENSMUST00000185698] [ENSMUST00000186572] [ENSMUST00000191228]
Predicted Effect probably damaging
Transcript: ENSMUST00000165062
AA Change: D84G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131631
Gene: ENSMUSG00000006007
AA Change: D84G

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185698
SMART Domains Protein: ENSMUSP00000140669
Gene: ENSMUSG00000006007

DomainStartEndE-ValueType
Pfam:Phosducin 1 79 2.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186460
Predicted Effect probably damaging
Transcript: ENSMUST00000186572
AA Change: D84G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140843
Gene: ENSMUSG00000006007
AA Change: D84G

DomainStartEndE-ValueType
Pfam:Phosducin 1 185 1.6e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191228
AA Change: D84G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141136
Gene: ENSMUSG00000006007
AA Change: D84G

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal retinal morphology and rod function with reduced transducin (Gnat1) translocation. Mice homozygous for a different knock-out allele exhibit large pupils, increased blood pressure, age-related vascular smooth muscle hypertrophy, and stress-induced hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Pdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Pdc APN 1 150333255 missense probably damaging 0.99
IGL02537:Pdc APN 1 150333009 missense possibly damaging 0.68
R0349:Pdc UTSW 1 150333427 missense probably benign 0.07
R0502:Pdc UTSW 1 150328414 splice site probably benign
R1167:Pdc UTSW 1 150333245 missense probably damaging 1.00
R1717:Pdc UTSW 1 150333141 missense probably damaging 1.00
R5182:Pdc UTSW 1 150333354 missense possibly damaging 0.84
R5449:Pdc UTSW 1 150333439 missense probably damaging 1.00
R5766:Pdc UTSW 1 150333500 makesense probably null
R6020:Pdc UTSW 1 150333366 missense probably benign 0.16
R6181:Pdc UTSW 1 150333270 missense probably damaging 1.00
R6425:Pdc UTSW 1 150333372 missense probably benign 0.37
R6660:Pdc UTSW 1 150333335 missense probably damaging 1.00
R6925:Pdc UTSW 1 150333180 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTATGTTAGAAGCAGGGGC -3'
(R):5'- AAGCTGCTGTTGAGTGCATCG -3'

Sequencing Primer
(F):5'- GGCAGCGTGGTCTAAGC -3'
(R):5'- TGTTGAGTGCATCGCAGCC -3'
Posted On2018-08-01