Incidental Mutation 'R6717:Cfap126'
ID529413
Institutional Source Beutler Lab
Gene Symbol Cfap126
Ensembl Gene ENSMUSG00000026649
Gene Namecilia and flagella associated protein 126
Synonyms1700009P17Rik, Fltp, Flattop
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score196.009
Status Validated
Chromosome1
Chromosomal Location171113918-171126967 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 171114102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129651] [ENSMUST00000151340]
Predicted Effect probably null
Transcript: ENSMUST00000129651
SMART Domains Protein: ENSMUSP00000114967
Gene: ENSMUSG00000026649

DomainStartEndE-ValueType
low complexity region 166 180 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151340
SMART Domains Protein: ENSMUSP00000123188
Gene: ENSMUSG00000026649

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Cfap126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Cfap126 APN 1 171126736 missense possibly damaging 0.46
PIT4514001:Cfap126 UTSW 1 171125312 missense probably damaging 1.00
R0014:Cfap126 UTSW 1 171125784 missense possibly damaging 0.55
R0466:Cfap126 UTSW 1 171126200 missense probably damaging 1.00
R1496:Cfap126 UTSW 1 171125817 utr 3 prime probably benign
R2317:Cfap126 UTSW 1 171126131 missense possibly damaging 0.82
R3684:Cfap126 UTSW 1 171114031 missense possibly damaging 0.83
R4601:Cfap126 UTSW 1 171114058 missense possibly damaging 0.81
R5960:Cfap126 UTSW 1 171125313 missense probably damaging 1.00
R6999:Cfap126 UTSW 1 171126164 missense possibly damaging 0.92
X0065:Cfap126 UTSW 1 171126739 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACGTAGTAGTGGTTTCTCAGAC -3'
(R):5'- AAGTACCCATTTCCCTTGCGG -3'

Sequencing Primer
(F):5'- CGAAGCGTTTCTTGACAGC -3'
(R):5'- CCTTGCGGGGTCTTTGGAG -3'
Posted On2018-08-01