Incidental Mutation 'R6717:Tmem132c'
ID529427
Institutional Source Beutler Lab
Gene Symbol Tmem132c
Ensembl Gene ENSMUSG00000034324
Gene Nametransmembrane protein 132C
Synonyms2810482M11Rik, 4632425D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location127241808-127565793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127564029 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1088 (L1088Q)
Ref Sequence ENSEMBL: ENSMUSP00000113090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119026]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119026
AA Change: L1088Q

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113090
Gene: ENSMUSG00000034324
AA Change: L1088Q

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:TMEM132D_N 58 187 1.2e-54 PFAM
Pfam:TMEM132 444 787 4.5e-143 PFAM
Pfam:TMEM132D_C 892 980 2.4e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132592
Predicted Effect probably benign
Transcript: ENSMUST00000145748
SMART Domains Protein: ENSMUSP00000121783
Gene: ENSMUSG00000034324

DomainStartEndE-ValueType
Pfam:TMEM132 1 112 6.2e-31 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Tmem132c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Tmem132c APN 5 127563242 missense possibly damaging 0.95
IGL00985:Tmem132c APN 5 127504866 missense probably damaging 0.99
IGL01599:Tmem132c APN 5 127359552 splice site probably benign
IGL01750:Tmem132c APN 5 127462959 missense possibly damaging 0.91
IGL01893:Tmem132c APN 5 127463029 missense possibly damaging 0.51
IGL02143:Tmem132c APN 5 127563402 missense probably benign 0.03
IGL02164:Tmem132c APN 5 127536377 missense probably damaging 1.00
IGL02252:Tmem132c APN 5 127462927 missense possibly damaging 0.91
IGL02527:Tmem132c APN 5 127359611 missense possibly damaging 0.95
IGL02584:Tmem132c APN 5 127504999 missense probably damaging 1.00
IGL02878:Tmem132c APN 5 127563090 missense probably damaging 0.99
IGL03065:Tmem132c APN 5 127563624 missense probably damaging 1.00
IGL03120:Tmem132c APN 5 127563384 missense probably benign 0.06
IGL03380:Tmem132c APN 5 127536442 missense probably benign 0.00
IGL03387:Tmem132c APN 5 127563720 missense probably benign 0.00
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0415:Tmem132c UTSW 5 127563705 missense probably damaging 1.00
R0607:Tmem132c UTSW 5 127563553 nonsense probably null
R1413:Tmem132c UTSW 5 127563567 missense probably damaging 1.00
R1531:Tmem132c UTSW 5 127359891 missense probably damaging 1.00
R1648:Tmem132c UTSW 5 127463056 splice site probably benign
R2148:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2149:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2259:Tmem132c UTSW 5 127504924 missense probably benign 0.01
R3853:Tmem132c UTSW 5 127359869 missense probably benign 0.00
R4204:Tmem132c UTSW 5 127563765 missense possibly damaging 0.73
R4543:Tmem132c UTSW 5 127504977 missense probably benign 0.00
R4701:Tmem132c UTSW 5 127564496 unclassified probably benign
R5017:Tmem132c UTSW 5 127563350 missense probably benign 0.13
R5037:Tmem132c UTSW 5 127553135 missense probably benign 0.42
R5327:Tmem132c UTSW 5 127563752 missense possibly damaging 0.50
R5423:Tmem132c UTSW 5 127563843 missense probably benign 0.02
R5548:Tmem132c UTSW 5 127551523 nonsense probably null
R6425:Tmem132c UTSW 5 127553265 missense possibly damaging 0.95
R6899:Tmem132c UTSW 5 127551680 missense probably damaging 1.00
R7007:Tmem132c UTSW 5 127359615 missense probably damaging 1.00
R7297:Tmem132c UTSW 5 127360217 missense probably benign 0.06
R7326:Tmem132c UTSW 5 127564059 missense possibly damaging 0.51
R7386:Tmem132c UTSW 5 127563926 missense probably benign 0.16
X0067:Tmem132c UTSW 5 127536407 missense possibly damaging 0.79
Z1088:Tmem132c UTSW 5 127504921 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCAACGGTGGCTCCCAAAAG -3'
(R):5'- ATTCTGTGGGCCCCAGATTTC -3'

Sequencing Primer
(F):5'- ACGCAGAGCCAGGTTCACAG -3'
(R):5'- GGGCCCCAGATTTCCTCAC -3'
Posted On2018-08-01