Incidental Mutation 'R6717:Flnc'
ID529430
Institutional Source Beutler Lab
Gene Symbol Flnc
Ensembl Gene ENSMUSG00000068699
Gene Namefilamin C, gamma
Synonyms1110055E19Rik, actin binding protein 280, Fln2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6717 (G1)
Quality Score217.468
Status Validated
Chromosome6
Chromosomal Location29433256-29461883 bp(+) (GRCm38)
Type of Mutationsmall deletion (4 aa in frame mutation)
DNA Base Change (assembly) AGCTGTCAAGTATGCTG to AGCTG at 29450902 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]
Predicted Effect probably benign
Transcript: ENSMUST00000065090
SMART Domains Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2737 2.11e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101617
SMART Domains Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 6.11e-32 SMART
IG_FLMN 1744 1825 2.93e-11 SMART
IG_FLMN 1826 1917 2.55e-43 SMART
IG_FLMN 1918 2004 2.43e-17 SMART
IG_FLMN 2008 2099 1.52e-41 SMART
PDB:2E9I|A 2100 2129 3e-7 PDB
IG_FLMN 2184 2277 2.93e-11 SMART
IG_FLMN 2281 2372 1.67e-38 SMART
IG_FLMN 2375 2467 2.56e-25 SMART
IG_FLMN 2472 2563 9.54e-34 SMART
low complexity region 2585 2595 N/A INTRINSIC
IG_FLMN 2602 2704 2.11e-26 SMART
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Flnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Flnc APN 6 29459547 nonsense probably null
IGL01099:Flnc APN 6 29433618 missense probably damaging 0.99
IGL01656:Flnc APN 6 29443508 splice site probably benign
IGL01659:Flnc APN 6 29448671 missense probably damaging 0.98
IGL01780:Flnc APN 6 29438493 nonsense probably null
IGL01935:Flnc APN 6 29454280 missense probably damaging 1.00
IGL02039:Flnc APN 6 29450719 missense probably benign 0.05
IGL02119:Flnc APN 6 29447512 missense probably damaging 0.98
IGL02122:Flnc APN 6 29444336 missense possibly damaging 0.70
IGL02236:Flnc APN 6 29454376 missense probably damaging 1.00
IGL02350:Flnc APN 6 29438493 nonsense probably null
IGL02357:Flnc APN 6 29438493 nonsense probably null
IGL02428:Flnc APN 6 29451485 missense probably damaging 1.00
IGL02496:Flnc APN 6 29440685 missense probably damaging 0.98
IGL02516:Flnc APN 6 29450841 missense probably damaging 0.99
IGL02696:Flnc APN 6 29446698 missense probably damaging 0.98
IGL03165:Flnc APN 6 29449378 missense probably damaging 1.00
IGL03190:Flnc APN 6 29445637 splice site probably benign
I1329:Flnc UTSW 6 29451415 missense probably damaging 1.00
R0111:Flnc UTSW 6 29454340 missense probably damaging 0.99
R0665:Flnc UTSW 6 29455531 missense probably damaging 1.00
R0748:Flnc UTSW 6 29446344 missense probably damaging 0.99
R0960:Flnc UTSW 6 29441512 missense probably damaging 1.00
R1328:Flnc UTSW 6 29438613 missense probably damaging 1.00
R1502:Flnc UTSW 6 29438694 missense probably benign 0.45
R1544:Flnc UTSW 6 29444080 missense probably benign 0.00
R1565:Flnc UTSW 6 29455171 missense probably damaging 1.00
R1640:Flnc UTSW 6 29433807 missense possibly damaging 0.78
R1691:Flnc UTSW 6 29441214 missense probably benign 0.09
R1818:Flnc UTSW 6 29457448 missense probably damaging 1.00
R1826:Flnc UTSW 6 29455185 missense probably damaging 0.99
R1851:Flnc UTSW 6 29443479 missense probably damaging 1.00
R1898:Flnc UTSW 6 29438666 nonsense probably null
R1905:Flnc UTSW 6 29459460 missense probably damaging 1.00
R1985:Flnc UTSW 6 29444416 splice site probably benign
R2016:Flnc UTSW 6 29443797 critical splice donor site probably null
R2017:Flnc UTSW 6 29443797 critical splice donor site probably null
R2020:Flnc UTSW 6 29444363 missense probably damaging 0.97
R2104:Flnc UTSW 6 29450735 critical splice donor site probably null
R2132:Flnc UTSW 6 29443676 missense probably damaging 1.00
R2141:Flnc UTSW 6 29448675 missense probably damaging 1.00
R2197:Flnc UTSW 6 29459135 missense probably damaging 1.00
R2202:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2203:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2204:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2205:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2209:Flnc UTSW 6 29455845 missense possibly damaging 0.91
R2248:Flnc UTSW 6 29451401 missense probably damaging 0.99
R2258:Flnc UTSW 6 29438666 nonsense probably null
R2259:Flnc UTSW 6 29438666 nonsense probably null
R2280:Flnc UTSW 6 29438666 nonsense probably null
R2281:Flnc UTSW 6 29438666 nonsense probably null
R2873:Flnc UTSW 6 29447543 missense probably damaging 0.96
R2900:Flnc UTSW 6 29448585 missense probably damaging 0.98
R3788:Flnc UTSW 6 29454057 missense probably damaging 0.99
R3799:Flnc UTSW 6 29443739 missense probably damaging 1.00
R3801:Flnc UTSW 6 29447404 missense probably damaging 0.98
R3851:Flnc UTSW 6 29453719 missense probably damaging 1.00
R3910:Flnc UTSW 6 29459427 missense probably damaging 1.00
R3982:Flnc UTSW 6 29442941 missense probably damaging 1.00
R3983:Flnc UTSW 6 29442941 missense probably damaging 1.00
R4023:Flnc UTSW 6 29451635 missense possibly damaging 0.95
R4676:Flnc UTSW 6 29445154 splice site probably null
R4694:Flnc UTSW 6 29443448 missense probably damaging 1.00
R4695:Flnc UTSW 6 29440429 missense probably damaging 0.99
R4735:Flnc UTSW 6 29455813 missense probably damaging 1.00
R4773:Flnc UTSW 6 29445039 missense possibly damaging 0.96
R4828:Flnc UTSW 6 29455167 missense probably damaging 1.00
R4856:Flnc UTSW 6 29447890 missense probably damaging 1.00
R4879:Flnc UTSW 6 29460806 missense probably damaging 0.99
R4899:Flnc UTSW 6 29446843 missense probably benign 0.17
R4906:Flnc UTSW 6 29447525 missense probably damaging 0.99
R5089:Flnc UTSW 6 29447813 missense probably damaging 0.96
R5173:Flnc UTSW 6 29455538 missense probably damaging 1.00
R5174:Flnc UTSW 6 29448894 missense possibly damaging 0.91
R5290:Flnc UTSW 6 29457554 missense probably damaging 1.00
R5338:Flnc UTSW 6 29444064 missense possibly damaging 0.47
R5352:Flnc UTSW 6 29449318 missense possibly damaging 0.85
R5397:Flnc UTSW 6 29441161 missense possibly damaging 0.87
R5431:Flnc UTSW 6 29456384 missense possibly damaging 0.74
R5481:Flnc UTSW 6 29441217 missense probably damaging 1.00
R5511:Flnc UTSW 6 29458898 missense probably damaging 1.00
R5539:Flnc UTSW 6 29446230 missense probably damaging 1.00
R5549:Flnc UTSW 6 29453691 missense probably damaging 1.00
R5567:Flnc UTSW 6 29444045 nonsense probably null
R5584:Flnc UTSW 6 29446628 missense probably damaging 0.98
R5689:Flnc UTSW 6 29441592 missense probably benign 0.03
R5753:Flnc UTSW 6 29433489 missense probably benign
R5786:Flnc UTSW 6 29459537 nonsense probably null
R5822:Flnc UTSW 6 29459430 missense probably damaging 0.98
R5823:Flnc UTSW 6 29461202 missense probably damaging 0.99
R5933:Flnc UTSW 6 29441106 missense probably damaging 0.99
R6043:Flnc UTSW 6 29446608 missense probably damaging 1.00
R6320:Flnc UTSW 6 29459063 missense probably damaging 1.00
R6337:Flnc UTSW 6 29454319 missense probably damaging 0.99
R6399:Flnc UTSW 6 29458883 missense probably damaging 1.00
R6423:Flnc UTSW 6 29445156 splice site probably null
R6540:Flnc UTSW 6 29446377 missense possibly damaging 0.96
R6547:Flnc UTSW 6 29448608 missense probably damaging 0.98
R6875:Flnc UTSW 6 29445749 missense probably damaging 1.00
R7193:Flnc UTSW 6 29450871 missense probably damaging 1.00
R7255:Flnc UTSW 6 29445766 missense probably damaging 1.00
R7303:Flnc UTSW 6 29460850 missense probably benign 0.31
Z1088:Flnc UTSW 6 29457151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGACTGCAGTCAAGCTG -3'
(R):5'- CTACAGGAAACCTTGGAGTGG -3'

Sequencing Primer
(F):5'- CTGGGCCCCACAGGTATG -3'
(R):5'- ACCTTGGAGTGGGGCAG -3'
Posted On2018-08-01