Incidental Mutation 'R6717:Srcap'
ID529434
Institutional Source Beutler Lab
Gene Symbol Srcap
Ensembl Gene ENSMUSG00000053877
Gene NameSnf2-related CREBBP activator protein
SynonymsD030022P06Rik, F630004O05Rik, B930091H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6717 (G1)
Quality Score107.467
Status Validated
Chromosome7
Chromosomal Location127511983-127561219 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCTCCTCCTCCTCCTCCT to GCTCCTCCTCCTCCT at 127558310 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000084563] [ENSMUST00000186954] [ENSMUST00000187040] [ENSMUST00000189629] [ENSMUST00000190278] [ENSMUST00000190390]
Predicted Effect probably benign
Transcript: ENSMUST00000084563
SMART Domains Protein: ENSMUSP00000081611
Gene: ENSMUSG00000106715

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
AT_hook 62 74 4.04e0 SMART
low complexity region 114 134 N/A INTRINSIC
AT_hook 142 154 4.46e-1 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 175 202 N/A INTRINSIC
AT_hook 206 218 3.94e-1 SMART
low complexity region 251 262 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 360 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186954
SMART Domains Protein: ENSMUSP00000139536
Gene: ENSMUSG00000053877

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1175 1194 N/A INTRINSIC
internal_repeat_1 1202 1245 2.24e-5 PROSPERO
low complexity region 1274 1302 N/A INTRINSIC
low complexity region 1304 1318 N/A INTRINSIC
low complexity region 1335 1353 N/A INTRINSIC
low complexity region 1355 1370 N/A INTRINSIC
low complexity region 1414 1441 N/A INTRINSIC
low complexity region 1452 1466 N/A INTRINSIC
low complexity region 1504 1533 N/A INTRINSIC
internal_repeat_1 1536 1579 2.24e-5 PROSPERO
internal_repeat_2 1537 1559 5.66e-5 PROSPERO
internal_repeat_2 1569 1589 5.66e-5 PROSPERO
low complexity region 1590 1607 N/A INTRINSIC
low complexity region 1609 1627 N/A INTRINSIC
low complexity region 1644 1678 N/A INTRINSIC
low complexity region 1713 1726 N/A INTRINSIC
low complexity region 1828 1840 N/A INTRINSIC
HELICc 1916 1999 1.2e-28 SMART
low complexity region 2058 2078 N/A INTRINSIC
coiled coil region 2166 2201 N/A INTRINSIC
low complexity region 2282 2348 N/A INTRINSIC
low complexity region 2374 2409 N/A INTRINSIC
low complexity region 2588 2600 N/A INTRINSIC
low complexity region 2642 2657 N/A INTRINSIC
low complexity region 2685 2712 N/A INTRINSIC
AT_hook 2745 2757 2.4e-2 SMART
low complexity region 2797 2817 N/A INTRINSIC
AT_hook 2825 2837 2.6e-3 SMART
low complexity region 2838 2849 N/A INTRINSIC
low complexity region 2858 2885 N/A INTRINSIC
AT_hook 2889 2901 2.4e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2946 2956 N/A INTRINSIC
low complexity region 3043 3079 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187040
SMART Domains Protein: ENSMUSP00000140036
Gene: ENSMUSG00000053877

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1277 1305 N/A INTRINSIC
low complexity region 1332 1351 N/A INTRINSIC
internal_repeat_1 1359 1402 1.78e-5 PROSPERO
low complexity region 1431 1459 N/A INTRINSIC
low complexity region 1461 1475 N/A INTRINSIC
low complexity region 1492 1510 N/A INTRINSIC
low complexity region 1512 1527 N/A INTRINSIC
low complexity region 1571 1598 N/A INTRINSIC
low complexity region 1609 1623 N/A INTRINSIC
low complexity region 1661 1690 N/A INTRINSIC
internal_repeat_1 1693 1736 1.78e-5 PROSPERO
internal_repeat_2 1694 1716 4.56e-5 PROSPERO
internal_repeat_2 1726 1746 4.56e-5 PROSPERO
low complexity region 1747 1764 N/A INTRINSIC
low complexity region 1766 1784 N/A INTRINSIC
low complexity region 1801 1835 N/A INTRINSIC
low complexity region 1870 1883 N/A INTRINSIC
low complexity region 1985 1997 N/A INTRINSIC
HELICc 2073 2156 1.2e-28 SMART
low complexity region 2215 2235 N/A INTRINSIC
coiled coil region 2323 2358 N/A INTRINSIC
low complexity region 2439 2505 N/A INTRINSIC
low complexity region 2531 2566 N/A INTRINSIC
low complexity region 2745 2757 N/A INTRINSIC
low complexity region 2799 2814 N/A INTRINSIC
low complexity region 2842 2869 N/A INTRINSIC
AT_hook 2902 2914 2.4e-2 SMART
low complexity region 2954 2974 N/A INTRINSIC
AT_hook 2982 2994 2.6e-3 SMART
low complexity region 2995 3006 N/A INTRINSIC
low complexity region 3015 3042 N/A INTRINSIC
AT_hook 3046 3058 2.4e-3 SMART
low complexity region 3091 3102 N/A INTRINSIC
low complexity region 3103 3113 N/A INTRINSIC
low complexity region 3200 3236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189629
SMART Domains Protein: ENSMUSP00000139644
Gene: ENSMUSG00000107023

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
HSA 106 177 5.4e-25 SMART
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 401 N/A INTRINSIC
low complexity region 461 539 N/A INTRINSIC
low complexity region 558 573 N/A INTRINSIC
DEXDc 607 799 5e-37 SMART
low complexity region 974 982 N/A INTRINSIC
low complexity region 1008 1023 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
low complexity region 1156 1175 N/A INTRINSIC
internal_repeat_1 1183 1226 2e-5 PROSPERO
low complexity region 1255 1283 N/A INTRINSIC
low complexity region 1285 1299 N/A INTRINSIC
low complexity region 1316 1334 N/A INTRINSIC
low complexity region 1336 1351 N/A INTRINSIC
low complexity region 1395 1422 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
low complexity region 1485 1514 N/A INTRINSIC
internal_repeat_1 1517 1560 2e-5 PROSPERO
internal_repeat_2 1518 1540 5.08e-5 PROSPERO
internal_repeat_2 1550 1570 5.08e-5 PROSPERO
low complexity region 1571 1588 N/A INTRINSIC
low complexity region 1590 1608 N/A INTRINSIC
low complexity region 1625 1659 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
low complexity region 1809 1821 N/A INTRINSIC
HELICc 1897 1980 1.2e-28 SMART
low complexity region 2039 2059 N/A INTRINSIC
coiled coil region 2147 2182 N/A INTRINSIC
low complexity region 2263 2329 N/A INTRINSIC
low complexity region 2355 2390 N/A INTRINSIC
low complexity region 2569 2581 N/A INTRINSIC
low complexity region 2623 2638 N/A INTRINSIC
low complexity region 2666 2693 N/A INTRINSIC
AT_hook 2726 2738 2.4e-2 SMART
low complexity region 2778 2798 N/A INTRINSIC
AT_hook 2806 2818 2.6e-3 SMART
low complexity region 2819 2830 N/A INTRINSIC
low complexity region 2839 2866 N/A INTRINSIC
AT_hook 2870 2882 2.4e-3 SMART
low complexity region 2915 2926 N/A INTRINSIC
low complexity region 2927 2937 N/A INTRINSIC
low complexity region 3024 3060 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190278
SMART Domains Protein: ENSMUSP00000144111
Gene: ENSMUSG00000106715

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190390
SMART Domains Protein: ENSMUSP00000139399
Gene: ENSMUSG00000053877

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1271 1290 N/A INTRINSIC
internal_repeat_1 1298 1341 2.01e-5 PROSPERO
low complexity region 1370 1398 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1431 1449 N/A INTRINSIC
low complexity region 1451 1466 N/A INTRINSIC
low complexity region 1510 1537 N/A INTRINSIC
low complexity region 1548 1562 N/A INTRINSIC
low complexity region 1600 1629 N/A INTRINSIC
internal_repeat_1 1632 1675 2.01e-5 PROSPERO
internal_repeat_2 1633 1655 5.11e-5 PROSPERO
internal_repeat_2 1665 1685 5.11e-5 PROSPERO
low complexity region 1686 1703 N/A INTRINSIC
low complexity region 1705 1723 N/A INTRINSIC
low complexity region 1740 1774 N/A INTRINSIC
low complexity region 1809 1822 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
HELICc 2012 2095 1.2e-28 SMART
low complexity region 2154 2174 N/A INTRINSIC
coiled coil region 2262 2297 N/A INTRINSIC
low complexity region 2378 2444 N/A INTRINSIC
low complexity region 2470 2505 N/A INTRINSIC
low complexity region 2684 2696 N/A INTRINSIC
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2781 2808 N/A INTRINSIC
AT_hook 2841 2853 2.4e-2 SMART
low complexity region 2893 2913 N/A INTRINSIC
AT_hook 2921 2933 2.6e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2954 2981 N/A INTRINSIC
AT_hook 2985 2997 2.4e-3 SMART
low complexity region 3030 3041 N/A INTRINSIC
low complexity region 3042 3052 N/A INTRINSIC
low complexity region 3139 3175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190938
Predicted Effect probably benign
Transcript: ENSMUST00000206825
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the core catalytic component of the multiprotein chromatin-remodeling SRCAP complex. The encoded protein is an ATPase that is necessary for the incorporation of the histone variant H2A.Z into nucleosomes. It can function as a transcriptional activator in Notch-mediated, CREB-mediated and steroid receptor-mediated transcription. Mutations in this gene cause Floating-Harbor syndrome, a rare disorder characterized by short stature, language deficits and dysmorphic facial features. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Srcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Srcap APN 7 127542713 splice site probably benign
IGL00475:Srcap APN 7 127552921 missense possibly damaging 0.92
IGL01064:Srcap APN 7 127559892 unclassified probably benign
IGL01129:Srcap APN 7 127521651 missense probably damaging 1.00
IGL01670:Srcap APN 7 127528432 missense probably damaging 1.00
IGL01861:Srcap APN 7 127525285 splice site probably benign
IGL02237:Srcap APN 7 127534692 splice site probably benign
IGL02665:Srcap APN 7 127540903 missense probably damaging 1.00
IGL02688:Srcap APN 7 127542453 missense probably benign 0.04
IGL02744:Srcap APN 7 127534666 missense probably damaging 1.00
IGL02810:Srcap APN 7 127521663 critical splice donor site probably null
IGL03184:Srcap APN 7 127530502 unclassified probably benign
IGL03309:Srcap APN 7 127530793 missense probably damaging 0.99
PIT4453001:Srcap UTSW 7 127549320 missense possibly damaging 0.52
R1340:Srcap UTSW 7 127560738 intron probably benign
R1401:Srcap UTSW 7 127559952 unclassified probably benign
R1455:Srcap UTSW 7 127530650 missense probably damaging 0.99
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1761:Srcap UTSW 7 127534845 missense probably damaging 1.00
R1911:Srcap UTSW 7 127534822 missense probably damaging 0.99
R2483:Srcap UTSW 7 127542147 missense probably damaging 0.99
R2892:Srcap UTSW 7 127539065 missense probably damaging 0.99
R2893:Srcap UTSW 7 127539065 missense probably damaging 0.99
R3623:Srcap UTSW 7 127542147 missense probably damaging 0.99
R3976:Srcap UTSW 7 127549239 missense probably benign 0.18
R4001:Srcap UTSW 7 127532167 missense probably damaging 1.00
R4015:Srcap UTSW 7 127525423 missense probably benign 0.27
R4581:Srcap UTSW 7 127558310 unclassified probably benign
R4643:Srcap UTSW 7 127541776 missense probably damaging 1.00
R4644:Srcap UTSW 7 127552598 missense probably damaging 1.00
R4690:Srcap UTSW 7 127538014 missense probably damaging 1.00
R4693:Srcap UTSW 7 127538544 missense probably damaging 1.00
R4719:Srcap UTSW 7 127541559 missense probably benign 0.13
R4728:Srcap UTSW 7 127540924 critical splice donor site probably null
R4740:Srcap UTSW 7 127549299 missense probably damaging 1.00
R4752:Srcap UTSW 7 127559000 unclassified probably benign
R4834:Srcap UTSW 7 127557610 critical splice donor site probably null
R4837:Srcap UTSW 7 127558962 unclassified probably benign
R4884:Srcap UTSW 7 127522017 missense probably damaging 1.00
R4889:Srcap UTSW 7 127538547 missense possibly damaging 0.94
R5088:Srcap UTSW 7 127541661 missense probably benign 0.02
R5102:Srcap UTSW 7 127530623 missense probably damaging 1.00
R5358:Srcap UTSW 7 127540320 missense probably damaging 1.00
R5372:Srcap UTSW 7 127557613 splice site probably null
R5397:Srcap UTSW 7 127553296 critical splice donor site probably null
R5481:Srcap UTSW 7 127532197 missense probably damaging 1.00
R5566:Srcap UTSW 7 127525303 missense probably damaging 0.99
R5584:Srcap UTSW 7 127528479 missense probably damaging 1.00
R5693:Srcap UTSW 7 127519816 missense probably damaging 1.00
R5769:Srcap UTSW 7 127559822 unclassified probably benign
R5805:Srcap UTSW 7 127542039 missense possibly damaging 0.87
R5806:Srcap UTSW 7 127559163 unclassified probably benign
R5921:Srcap UTSW 7 127558833 unclassified probably benign
R5942:Srcap UTSW 7 127538008 missense probably damaging 1.00
R6014:Srcap UTSW 7 127538750 missense probably benign 0.01
R6057:Srcap UTSW 7 127541356 missense probably damaging 0.99
R6113:Srcap UTSW 7 127560281 unclassified probably benign
R6150:Srcap UTSW 7 127534828 missense probably damaging 1.00
R6212:Srcap UTSW 7 127549689 missense probably damaging 1.00
R6299:Srcap UTSW 7 127530454 unclassified probably benign
R6437:Srcap UTSW 7 127528550 intron probably null
R6492:Srcap UTSW 7 127522145 nonsense probably null
R6537:Srcap UTSW 7 127542220 missense probably damaging 0.97
R6659:Srcap UTSW 7 127542391 missense probably damaging 1.00
R6713:Srcap UTSW 7 127534917 missense probably benign 0.28
R6941:Srcap UTSW 7 127542597 missense probably damaging 1.00
R7068:Srcap UTSW 7 127541943 missense probably benign 0.00
R7097:Srcap UTSW 7 127539041 missense probably damaging 1.00
R7394:Srcap UTSW 7 127534828 missense probably damaging 1.00
X0025:Srcap UTSW 7 127560105 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTGTGGAAGTAGTGGAGCCAG -3'
(R):5'- TGGCTAGGGCAGAAGTTATAGC -3'

Sequencing Primer
(F):5'- GCAGCAAGAAAATCAGGGCTCC -3'
(R):5'- CTAGGGCAGAAGTTATAGCAGAAGC -3'
Posted On2018-08-01