Incidental Mutation 'R6721:Npy1r'
ID529590
Institutional Source Beutler Lab
Gene Symbol Npy1r
Ensembl Gene ENSMUSG00000036437
Gene Nameneuropeptide Y receptor Y1
SynonymsY1-R, Npyr
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6721 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location66697192-66706792 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 66704289 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 120 (C120*)
Ref Sequence ENSEMBL: ENSMUSP00000148417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039303] [ENSMUST00000212588]
Predicted Effect probably null
Transcript: ENSMUST00000039303
AA Change: C120*
SMART Domains Protein: ENSMUSP00000045530
Gene: ENSMUSG00000036437
AA Change: C120*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 50 334 7.8e-11 PFAM
Pfam:7tm_1 56 319 1.1e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212588
AA Change: C120*
Meta Mutation Damage Score 0.698 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein-coupled receptor superfamily. The encoded transmembrane protein mediates the function of neuropeptide Y (NPY), a neurotransmitter, and peptide YY (PYY), a gastrointestinal hormone. The encoded receptor undergoes fast agonist-induced internalization through clathrin-coated pits and is subsequently recycled back to the cell membrane. Activation of Y1 receptors may result in mobilization of intracellular calcium and inhibition of adenylate cyclase activity. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit moderate obesity, mild hyperinsulinemia, reduced activity and energy expenditure, lowered fast-induced refeeding, hyperalgesia, increased neuropathic pain, and resistance to barbiturates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,874,744 N44D probably benign Het
2610507B11Rik T C 11: 78,279,799 Y1615H probably damaging Het
Adgrv1 A G 13: 81,481,515 L3588S probably benign Het
Ankrd27 T C 7: 35,612,551 F402S probably damaging Het
Aplp1 T C 7: 30,440,295 Q359R probably null Het
Arhgef10l T C 4: 140,570,344 Y546C probably damaging Het
Cd46 T C 1: 195,083,631 Y142C probably damaging Het
Chd3 T C 11: 69,369,219 probably benign Het
Cmtm2b A G 8: 104,322,445 S31G possibly damaging Het
CN725425 A G 15: 91,231,618 K21R possibly damaging Het
Cngb1 T C 8: 95,270,888 T560A probably benign Het
Creb3l3 T C 10: 81,091,143 D151G probably damaging Het
Cts7 A T 13: 61,356,294 V124E probably damaging Het
Ctsd G A 7: 142,376,853 P349S possibly damaging Het
Ern1 A G 11: 106,411,652 W459R probably damaging Het
Faxc A T 4: 21,982,672 probably null Het
Gabbr1 T C 17: 37,054,192 I239T probably damaging Het
Galnt12 T A 4: 47,122,529 C269* probably null Het
Gmpr2 A T 14: 55,672,734 D7V probably damaging Het
Hivep3 T A 4: 120,095,099 I204N possibly damaging Het
Il16 A T 7: 83,663,062 probably null Het
Jag1 T C 2: 137,094,474 T367A probably benign Het
Lefty2 T C 1: 180,894,601 V168A probably damaging Het
Mecom T C 3: 29,979,874 E227G probably damaging Het
Muc5ac T A 7: 141,798,992 C739S possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Ogfr T A 2: 180,595,428 L602Q possibly damaging Het
Olfr1564 C T 17: 33,215,534 G270E probably benign Het
Olfr18 A C 9: 20,314,280 D213E probably benign Het
Olfr978 C T 9: 39,994,307 P166S possibly damaging Het
Perm1 G T 4: 156,218,319 R440L probably benign Het
Plcb4 T C 2: 135,910,237 V121A probably benign Het
Plxna4 C T 6: 32,200,859 V1036M probably benign Het
Ppl A T 16: 5,107,469 M102K probably damaging Het
Prop1 T C 11: 50,953,386 S7G probably benign Het
Rabggta A G 14: 55,717,203 L507P probably damaging Het
Sfmbt2 A G 2: 10,543,025 T473A probably damaging Het
Spc25 A C 2: 69,197,173 M125R possibly damaging Het
Taok3 T C 5: 117,255,863 M567T probably benign Het
Tlr3 A G 8: 45,398,880 Y327H probably benign Het
Tmem209 A G 6: 30,497,175 F339L probably benign Het
U2surp T C 9: 95,491,104 N279S probably damaging Het
Ythdf3 G A 3: 16,203,861 M61I possibly damaging Het
Zfp647 T C 15: 76,911,876 I195V probably benign Het
Other mutations in Npy1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Npy1r APN 8 66704776 missense probably benign
IGL01629:Npy1r APN 8 66704221 missense probably benign 0.01
IGL02338:Npy1r APN 8 66704302 missense probably damaging 1.00
IGL02651:Npy1r APN 8 66705023 missense possibly damaging 0.80
Bowery UTSW 8 66704203 missense probably damaging 1.00
R0534:Npy1r UTSW 8 66705018 missense probably damaging 1.00
R1518:Npy1r UTSW 8 66704195 missense probably benign 0.05
R1575:Npy1r UTSW 8 66704161 missense probably damaging 1.00
R1768:Npy1r UTSW 8 66704525 missense possibly damaging 0.49
R2144:Npy1r UTSW 8 66705184 missense probably benign 0.18
R2280:Npy1r UTSW 8 66704059 missense possibly damaging 0.94
R3775:Npy1r UTSW 8 66704850 missense possibly damaging 0.90
R5678:Npy1r UTSW 8 66704203 missense probably damaging 1.00
X0022:Npy1r UTSW 8 66705109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTCTGGAAACCTGGCATTG -3'
(R):5'- GACACATTTTGGAAGGGCTCG -3'

Sequencing Primer
(F):5'- CTGGAAACCTGGCATTGATCATAATC -3'
(R):5'- CGTCGGTCAGAATTTGATAGATCAC -3'
Posted On2018-08-01