Incidental Mutation 'R6721:CN725425'
ID529607
Institutional Source Beutler Lab
Gene Symbol CN725425
Ensembl Gene ENSMUSG00000078932
Gene NamecDNA sequence CN725425
SynonymsGm5807
MMRRC Submission
Accession Numbers

Ensembl: ENSMUST00000109284; MGI: 3613655

Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6721 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location91199494-91260894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91231618 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 21 (K21R)
Ref Sequence ENSEMBL: ENSMUSP00000140772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109284] [ENSMUST00000190436]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109284
AA Change: K14R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104907
Gene: ENSMUSG00000078932
AA Change: K14R

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
Pfam:DUF4552 219 643 2.7e-202 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190436
AA Change: K21R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140772
Gene: ENSMUSG00000078932
AA Change: K21R

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
Pfam:DUF4552 226 650 1.4e-184 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,874,744 N44D probably benign Het
2610507B11Rik T C 11: 78,279,799 Y1615H probably damaging Het
Adgrv1 A G 13: 81,481,515 L3588S probably benign Het
Ankrd27 T C 7: 35,612,551 F402S probably damaging Het
Aplp1 T C 7: 30,440,295 Q359R probably null Het
Arhgef10l T C 4: 140,570,344 Y546C probably damaging Het
Cd46 T C 1: 195,083,631 Y142C probably damaging Het
Chd3 T C 11: 69,369,219 probably benign Het
Cmtm2b A G 8: 104,322,445 S31G possibly damaging Het
Cngb1 T C 8: 95,270,888 T560A probably benign Het
Creb3l3 T C 10: 81,091,143 D151G probably damaging Het
Cts7 A T 13: 61,356,294 V124E probably damaging Het
Ctsd G A 7: 142,376,853 P349S possibly damaging Het
Ern1 A G 11: 106,411,652 W459R probably damaging Het
Faxc A T 4: 21,982,672 probably null Het
Gabbr1 T C 17: 37,054,192 I239T probably damaging Het
Galnt12 T A 4: 47,122,529 C269* probably null Het
Gmpr2 A T 14: 55,672,734 D7V probably damaging Het
Hivep3 T A 4: 120,095,099 I204N possibly damaging Het
Il16 A T 7: 83,663,062 probably null Het
Jag1 T C 2: 137,094,474 T367A probably benign Het
Lefty2 T C 1: 180,894,601 V168A probably damaging Het
Mecom T C 3: 29,979,874 E227G probably damaging Het
Muc5ac T A 7: 141,798,992 C739S possibly damaging Het
Npy1r T A 8: 66,704,289 C120* probably null Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Ogfr T A 2: 180,595,428 L602Q possibly damaging Het
Olfr1564 C T 17: 33,215,534 G270E probably benign Het
Olfr18 A C 9: 20,314,280 D213E probably benign Het
Olfr978 C T 9: 39,994,307 P166S possibly damaging Het
Perm1 G T 4: 156,218,319 R440L probably benign Het
Plcb4 T C 2: 135,910,237 V121A probably benign Het
Plxna4 C T 6: 32,200,859 V1036M probably benign Het
Ppl A T 16: 5,107,469 M102K probably damaging Het
Prop1 T C 11: 50,953,386 S7G probably benign Het
Rabggta A G 14: 55,717,203 L507P probably damaging Het
Sfmbt2 A G 2: 10,543,025 T473A probably damaging Het
Spc25 A C 2: 69,197,173 M125R possibly damaging Het
Taok3 T C 5: 117,255,863 M567T probably benign Het
Tlr3 A G 8: 45,398,880 Y327H probably benign Het
Tmem209 A G 6: 30,497,175 F339L probably benign Het
U2surp T C 9: 95,491,104 N279S probably damaging Het
Ythdf3 G A 3: 16,203,861 M61I possibly damaging Het
Zfp647 T C 15: 76,911,876 I195V probably benign Het
Other mutations in CN725425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:CN725425 APN 15 91245752 missense possibly damaging 0.71
IGL02176:CN725425 APN 15 91245821 missense probably benign
3-1:CN725425 UTSW 15 91260521 missense possibly damaging 0.52
R0449:CN725425 UTSW 15 91238944 missense possibly damaging 0.73
R0554:CN725425 UTSW 15 91260763 missense possibly damaging 0.86
R1442:CN725425 UTSW 15 91238955 missense possibly damaging 0.96
R1670:CN725425 UTSW 15 91245815 missense possibly damaging 0.86
R1674:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R2425:CN725425 UTSW 15 91245855 missense probably damaging 0.97
R3966:CN725425 UTSW 15 91242687 critical splice donor site probably null
R4959:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R4973:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R5506:CN725425 UTSW 15 91235826 missense possibly damaging 0.85
R5512:CN725425 UTSW 15 91240756 missense probably benign
R5726:CN725425 UTSW 15 91260503 missense possibly damaging 0.85
R5808:CN725425 UTSW 15 91245644 missense probably benign 0.32
R5820:CN725425 UTSW 15 91260697 missense possibly damaging 0.71
R5945:CN725425 UTSW 15 91245777 missense possibly damaging 0.86
R6366:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R6441:CN725425 UTSW 15 91235802 missense probably benign 0.33
R6484:CN725425 UTSW 15 91260572 missense probably benign 0.32
R6523:CN725425 UTSW 15 91231581 missense probably benign 0.01
R6901:CN725425 UTSW 15 91240763 missense possibly damaging 0.93
Z1088:CN725425 UTSW 15 91245762 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGGTTCAGTAAACACCGTTTC -3'
(R):5'- ATCATTGTAAGTGTCTGCTTGAGC -3'

Sequencing Primer
(F):5'- GGTTCAGTAAACACCGTTTCTAATGC -3'
(R):5'- GTCTGGAAGACTAGAACTCACTATG -3'
Posted On2018-08-01