Incidental Mutation 'R6722:Prss51'
ID529656
Institutional Source Beutler Lab
Gene Symbol Prss51
Ensembl Gene ENSMUSG00000052099
Gene Nameprotease, serine 51
Synonyms1700007N14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location64086234-64097678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64095059 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 65 (C65F)
Ref Sequence ENSEMBL: ENSMUSP00000153617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063785] [ENSMUST00000165710] [ENSMUST00000170709] [ENSMUST00000224112]
Predicted Effect probably benign
Transcript: ENSMUST00000063785
SMART Domains Protein: ENSMUSP00000066111
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Tryp_SPc 5 171 3.93e-9 SMART
low complexity region 181 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165710
SMART Domains Protein: ENSMUSP00000132814
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Tryp_SPc 9 189 2.09e-13 SMART
low complexity region 199 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169113
Predicted Effect probably benign
Transcript: ENSMUST00000170709
SMART Domains Protein: ENSMUSP00000126778
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Pfam:Trypsin 2 94 2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224112
AA Change: C65F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.0424 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Prss51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Prss51 APN 14 64095984 missense probably damaging 1.00
PIT4354001:Prss51 UTSW 14 64097097 missense probably damaging 0.99
R0453:Prss51 UTSW 14 64097139 missense probably damaging 1.00
R1335:Prss51 UTSW 14 64096171 critical splice donor site probably null
R1479:Prss51 UTSW 14 64096170 critical splice donor site probably null
R3753:Prss51 UTSW 14 64096175 splice site probably benign
R5384:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R5385:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R5386:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R6522:Prss51 UTSW 14 64097406 missense possibly damaging 0.90
R6908:Prss51 UTSW 14 64096152 missense probably benign 0.00
R6919:Prss51 UTSW 14 64097488 missense probably damaging 1.00
R7220:Prss51 UTSW 14 64095995 nonsense probably null
X0024:Prss51 UTSW 14 64097466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTAAGTGGGAAGGCTCTGAG -3'
(R):5'- GGGACAGACTTCACTCCAAAG -3'

Sequencing Primer
(F):5'- TTAAGTGGGAAGGCTCTGAGAATGTG -3'
(R):5'- AGCCACCAGGAGCAGAGC -3'
Posted On2018-08-01