Incidental Mutation 'R6722:Triobp'
ID529657
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79001565 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1823 (E1823K)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109687
AA Change: E436K

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: E436K

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109689
AA Change: E1777K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: E1777K

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: E1823K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: E1823K

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Meta Mutation Damage Score 0.428 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACACAGGATTGCCTCAAAGGG -3'
(R):5'- CTTGGGCACTGTTGACTCATG -3'

Sequencing Primer
(F):5'- GAGGTTGACCAGCTCTCACAAAG -3'
(R):5'- GACTCATGTGATCTCTGCCAAGG -3'
Posted On2018-08-01