Incidental Mutation 'R6723:Rae1'
ID529675
Institutional Source Beutler Lab
Gene Symbol Rae1
Ensembl Gene ENSMUSG00000027509
Gene Nameribonucleic acid export 1
SynonymsD2Ertd342e, MNRP, MNRP41, 41
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6723 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location173000117-173015739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173012248 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000029013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029013] [ENSMUST00000132212]
Predicted Effect probably damaging
Transcript: ENSMUST00000029013
AA Change: I273T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029013
Gene: ENSMUSG00000027509
AA Change: I273T

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
WD40 28 70 9.59e-1 SMART
WD40 76 114 9.82e-8 SMART
WD40 117 157 1.12e-2 SMART
Blast:WD40 160 195 2e-9 BLAST
Blast:WD40 202 244 8e-10 BLAST
WD40 250 301 1.14e-3 SMART
Blast:WD40 304 346 7e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124793
Predicted Effect probably benign
Transcript: ENSMUST00000132212
SMART Domains Protein: ENSMUSP00000121815
Gene: ENSMUSG00000027509

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
WD40 28 70 9.59e-1 SMART
WD40 76 114 9.82e-8 SMART
WD40 117 157 1.12e-2 SMART
Blast:WD40 160 195 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138237
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in the Schizosaccharomyces pombe Rae1 and Saccharomyces cerevisiae Gle2 genes have been shown to result in accumulation of poly(A)-containing mRNA in the nucleus, suggesting that the encoded proteins are involved in RNA export. The protein encoded by this gene is a homolog of yeast Rae1. It contains four WD40 motifs, and has been shown to localize to distinct foci in the nucleoplasm, to the nuclear rim, and to meshwork-like structures throughout the cytoplasm. This gene is thought to be involved in nucleocytoplasmic transport, and in directly or indirectly attaching cytoplasmic mRNPs to the cytoskeleton. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are embryonic lethal. Heterozygous mutant mice exhibit a mitotic checkpoint defect and chromosome missegregation as well as an increased incidence of chemically-induced lung tumors; however, no spontaneous tumor formation or signs of early aging are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,823 Y2451C possibly damaging Het
Ahnak2 A G 12: 112,778,793 S740P probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bcl11a C A 11: 24,163,646 P330T probably damaging Het
Cyp2d12 A T 15: 82,556,884 I124F probably benign Het
Dhdds T C 4: 133,994,265 T74A probably damaging Het
Dio3 G A 12: 110,279,557 C109Y possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Efcab3 A T 11: 105,117,080 T329S possibly damaging Het
Esp1 A T 17: 40,728,856 I11L probably benign Het
Fam13b A T 18: 34,498,026 H33Q possibly damaging Het
Fam13c G A 10: 70,554,525 D539N probably damaging Het
Fgd5 A G 6: 91,988,030 T257A probably benign Het
Gm5134 A G 10: 76,008,619 D603G probably benign Het
Gtpbp2 T C 17: 46,168,276 V588A probably benign Het
Ift140 A G 17: 25,033,116 I312M probably benign Het
Inpp5j T C 11: 3,500,640 N571S probably damaging Het
Iqgap1 T G 7: 80,723,822 D1473A probably benign Het
Ivl T G 3: 92,571,387 K457T unknown Het
Kdm3b T C 18: 34,793,005 I66T probably damaging Het
Kif21a A T 15: 90,940,446 M1430K probably damaging Het
Klhl25 T A 7: 75,865,991 L215Q possibly damaging Het
Lim2 T A 7: 43,435,675 M163K probably benign Het
Lrig1 T C 6: 94,626,405 D254G probably damaging Het
Mff A G 1: 82,751,666 I122V possibly damaging Het
Mrpl15 A C 1: 4,782,566 probably null Het
Mylk A G 16: 34,929,888 Y1199C possibly damaging Het
Nlrp3 G A 11: 59,565,192 C938Y probably damaging Het
Notch1 T C 2: 26,478,106 N623D probably damaging Het
Obscn T G 11: 59,054,998 E4129A probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1423 A G 19: 12,036,275 S156P probably damaging Het
Olfr173 T C 16: 58,797,432 K138R probably benign Het
Olfr517 A T 7: 108,868,588 C189S probably damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Parm1 C T 5: 91,622,997 P291S probably damaging Het
Pcsk1 T A 13: 75,093,069 probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Piezo1 T G 8: 122,507,627 Q93H probably benign Het
Pkd2l2 A T 18: 34,438,157 Y575F probably damaging Het
Plekhn1 A C 4: 156,224,569 F258C probably damaging Het
Pole C T 5: 110,323,616 H1409Y probably benign Het
Rag1 A G 2: 101,643,645 V384A probably damaging Het
Rnaseh1 T C 12: 28,649,762 L25P probably damaging Het
Serpinb12 A G 1: 106,949,158 H68R probably benign Het
Sh3tc2 A T 18: 61,977,954 I294F probably damaging Het
Sirpb1b A C 3: 15,548,798 L75V possibly damaging Het
Slc12a6 A T 2: 112,337,942 T277S probably damaging Het
Slc7a12 A T 3: 14,499,197 E43D probably benign Het
Spata31d1c T A 13: 65,035,944 D433E probably benign Het
Tbl2 A T 5: 135,159,276 Y308F probably damaging Het
Tfec T C 6: 16,835,302 Y159C probably damaging Het
Tmem8 C A 17: 26,120,636 T616N probably damaging Het
Top1mt G T 15: 75,667,433 T371K probably benign Het
Trim24 T C 6: 37,951,468 V541A probably benign Het
Ttc16 T C 2: 32,768,037 Y456C possibly damaging Het
Ttn G A 2: 76,770,097 R17204* probably null Het
Ugt1a6b T C 1: 88,107,717 V259A probably benign Het
Unc5a T C 13: 54,995,889 W129R probably benign Het
Vmn1r63 T A 7: 5,802,949 H228L probably damaging Het
Whamm G T 7: 81,596,120 V775F probably damaging Het
Zfc3h1 T A 10: 115,420,733 I1536N probably benign Het
Zfp1 T C 8: 111,670,339 S317P probably damaging Het
Zfp58 T C 13: 67,494,073 T52A probably damaging Het
Other mutations in Rae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Rae1 APN 2 173006933 missense probably damaging 0.98
IGL02103:Rae1 APN 2 173003513 missense probably damaging 1.00
R0012:Rae1 UTSW 2 173002673 missense unknown
R0012:Rae1 UTSW 2 173002673 missense unknown
R0684:Rae1 UTSW 2 173005164 missense probably damaging 1.00
R1725:Rae1 UTSW 2 173006961 missense possibly damaging 0.77
R3813:Rae1 UTSW 2 173006873 splice site probably benign
R4537:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4540:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4710:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4731:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4979:Rae1 UTSW 2 173012608 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATTGAGGGGAGAGTTGCCATTC -3'
(R):5'- CAACCTCAGGGAAAAGTGTGC -3'

Sequencing Primer
(F):5'- GGGAGAGTTGCCATTCACTACATC -3'
(R):5'- CCTCAGGGAAAAGTGTGCATTTC -3'
Posted On2018-08-01