Incidental Mutation 'R6723:Whamm'
ID529693
Institutional Source Beutler Lab
Gene Symbol Whamm
Ensembl Gene ENSMUSG00000045795
Gene NameWAS protein homolog associated with actin, golgi membranes and microtubules
SynonymsWhdc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6723 (G1)
Quality Score169.009
Status Not validated
Chromosome7
Chromosomal Location81571266-81596836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81596120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 775 (V775F)
Ref Sequence ENSEMBL: ENSMUSP00000128881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098326] [ENSMUST00000165460] [ENSMUST00000207123] [ENSMUST00000209044]
Predicted Effect probably benign
Transcript: ENSMUST00000098326
SMART Domains Protein: ENSMUSP00000095931
Gene: ENSMUSG00000025813

DomainStartEndE-ValueType
Pfam:WH1 1 43 4.6e-11 PFAM
coiled coil region 98 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165460
AA Change: V775F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128881
Gene: ENSMUSG00000045795
AA Change: V775F

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 54 1.1e-30 PFAM
Pfam:JMY 67 435 1.3e-157 PFAM
coiled coil region 448 470 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 631 656 N/A INTRINSIC
WH2 698 716 5.69e2 SMART
WH2 728 745 6.26e-2 SMART
coiled coil region 758 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208537
Predicted Effect probably damaging
Transcript: ENSMUST00000209044
AA Change: V471F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in actin nucleation, Golgi membrane association and microtubule binding. The encoded protein is a nucleation-promoting factor that regulates the Actin-related protein 2/3 complex. The activated complex initiates growth of new actin filaments by binding to existing actin filaments. The encoded protein also functions in regulation of transport from the endoplasmic reticulum to the Golgi complex and in maintenance of the Golgi complex near the centrosome. Four pseudogenes of this gene are present on the same arm of chromosome 15 as this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,823 Y2451C possibly damaging Het
Ahnak2 A G 12: 112,778,793 S740P probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bcl11a C A 11: 24,163,646 P330T probably damaging Het
Cyp2d12 A T 15: 82,556,884 I124F probably benign Het
Dhdds T C 4: 133,994,265 T74A probably damaging Het
Dio3 G A 12: 110,279,557 C109Y possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Efcab3 A T 11: 105,117,080 T329S possibly damaging Het
Esp1 A T 17: 40,728,856 I11L probably benign Het
Fam13b A T 18: 34,498,026 H33Q possibly damaging Het
Fam13c G A 10: 70,554,525 D539N probably damaging Het
Fgd5 A G 6: 91,988,030 T257A probably benign Het
Gm5134 A G 10: 76,008,619 D603G probably benign Het
Gtpbp2 T C 17: 46,168,276 V588A probably benign Het
Ift140 A G 17: 25,033,116 I312M probably benign Het
Inpp5j T C 11: 3,500,640 N571S probably damaging Het
Iqgap1 T G 7: 80,723,822 D1473A probably benign Het
Ivl T G 3: 92,571,387 K457T unknown Het
Kdm3b T C 18: 34,793,005 I66T probably damaging Het
Kif21a A T 15: 90,940,446 M1430K probably damaging Het
Klhl25 T A 7: 75,865,991 L215Q possibly damaging Het
Lim2 T A 7: 43,435,675 M163K probably benign Het
Lrig1 T C 6: 94,626,405 D254G probably damaging Het
Mff A G 1: 82,751,666 I122V possibly damaging Het
Mrpl15 A C 1: 4,782,566 probably null Het
Mylk A G 16: 34,929,888 Y1199C possibly damaging Het
Nlrp3 G A 11: 59,565,192 C938Y probably damaging Het
Notch1 T C 2: 26,478,106 N623D probably damaging Het
Obscn T G 11: 59,054,998 E4129A probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1423 A G 19: 12,036,275 S156P probably damaging Het
Olfr173 T C 16: 58,797,432 K138R probably benign Het
Olfr517 A T 7: 108,868,588 C189S probably damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Parm1 C T 5: 91,622,997 P291S probably damaging Het
Pcsk1 T A 13: 75,093,069 probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Piezo1 T G 8: 122,507,627 Q93H probably benign Het
Pkd2l2 A T 18: 34,438,157 Y575F probably damaging Het
Plekhn1 A C 4: 156,224,569 F258C probably damaging Het
Pole C T 5: 110,323,616 H1409Y probably benign Het
Rae1 T C 2: 173,012,248 I273T probably damaging Het
Rag1 A G 2: 101,643,645 V384A probably damaging Het
Rnaseh1 T C 12: 28,649,762 L25P probably damaging Het
Serpinb12 A G 1: 106,949,158 H68R probably benign Het
Sh3tc2 A T 18: 61,977,954 I294F probably damaging Het
Sirpb1b A C 3: 15,548,798 L75V possibly damaging Het
Slc12a6 A T 2: 112,337,942 T277S probably damaging Het
Slc7a12 A T 3: 14,499,197 E43D probably benign Het
Spata31d1c T A 13: 65,035,944 D433E probably benign Het
Tbl2 A T 5: 135,159,276 Y308F probably damaging Het
Tfec T C 6: 16,835,302 Y159C probably damaging Het
Tmem8 C A 17: 26,120,636 T616N probably damaging Het
Top1mt G T 15: 75,667,433 T371K probably benign Het
Trim24 T C 6: 37,951,468 V541A probably benign Het
Ttc16 T C 2: 32,768,037 Y456C possibly damaging Het
Ttn G A 2: 76,770,097 R17204* probably null Het
Ugt1a6b T C 1: 88,107,717 V259A probably benign Het
Unc5a T C 13: 54,995,889 W129R probably benign Het
Vmn1r63 T A 7: 5,802,949 H228L probably damaging Het
Zfc3h1 T A 10: 115,420,733 I1536N probably benign Het
Zfp1 T C 8: 111,670,339 S317P probably damaging Het
Zfp58 T C 13: 67,494,073 T52A probably damaging Het
Other mutations in Whamm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Whamm APN 7 81578266 missense probably damaging 1.00
IGL01139:Whamm APN 7 81595914 missense probably damaging 1.00
IGL01870:Whamm APN 7 81595974 missense probably damaging 0.96
IGL03153:Whamm APN 7 81589532 splice site probably benign
R0179:Whamm UTSW 7 81594015 missense probably benign 0.00
R0364:Whamm UTSW 7 81594051 missense probably benign 0.00
R0550:Whamm UTSW 7 81586224 missense possibly damaging 0.55
R0682:Whamm UTSW 7 81586138 missense probably damaging 1.00
R1388:Whamm UTSW 7 81586290 missense probably damaging 1.00
R1940:Whamm UTSW 7 81578299 missense probably null 0.94
R1991:Whamm UTSW 7 81591771 nonsense probably null
R1992:Whamm UTSW 7 81591771 nonsense probably null
R2103:Whamm UTSW 7 81591771 nonsense probably null
R2104:Whamm UTSW 7 81591771 nonsense probably null
R2162:Whamm UTSW 7 81571341 missense probably damaging 1.00
R2291:Whamm UTSW 7 81591771 nonsense probably null
R3078:Whamm UTSW 7 81571784 missense probably damaging 1.00
R4735:Whamm UTSW 7 81571374 missense probably benign 0.01
R6336:Whamm UTSW 7 81591764 missense probably damaging 1.00
R6747:Whamm UTSW 7 81578302 critical splice donor site probably null
R7029:Whamm UTSW 7 81591826 missense probably benign 0.09
R7286:Whamm UTSW 7 81586247 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCTCCGGAAAGTAGAAACGCC -3'
(R):5'- GACAAAGTCCTGTCCCCATG -3'

Sequencing Primer
(F):5'- GGAAAGTAGAAACGCCCACCTTG -3'
(R):5'- TACCCCGCAGTGAGTGTTG -3'
Posted On2018-08-01