Incidental Mutation 'R6723:Unc5a'
ID529710
Institutional Source Beutler Lab
Gene Symbol Unc5a
Ensembl Gene ENSMUSG00000025876
Gene Nameunc-5 netrin receptor A
SynonymsUnc5h1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6723 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location54949411-55006018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54995889 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 129 (W129R)
Ref Sequence ENSEMBL: ENSMUSP00000105621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000109994] [ENSMUST00000136852]
Predicted Effect probably benign
Transcript: ENSMUST00000026994
AA Change: W129R

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876
AA Change: W129R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 296 1.25e-14 SMART
TSP1 301 350 1.98e-8 SMART
transmembrane domain 360 382 N/A INTRINSIC
ZU5 495 598 3.68e-58 SMART
DEATH 805 896 5.86e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109994
AA Change: W129R

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876
AA Change: W129R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 294 1.98e-8 SMART
transmembrane domain 305 327 N/A INTRINSIC
ZU5 439 542 3.68e-58 SMART
DEATH 749 840 5.86e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136852
SMART Domains Protein: ENSMUSP00000116585
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
TSP1 20 70 1.23e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC5A belongs to a family of netrin-1 (MIM 601614) receptors thought to mediate the chemorepulsive effect of netrin-1 on specific axons. For more information on UNC5 proteins, see UNC5C (MIM 603610).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are viable through adulthood but display decreased apoptotic cell death, supernumerary neurons and morphological alterations in the embryonic cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,823 Y2451C possibly damaging Het
Ahnak2 A G 12: 112,778,793 S740P probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bcl11a C A 11: 24,163,646 P330T probably damaging Het
Cyp2d12 A T 15: 82,556,884 I124F probably benign Het
Dhdds T C 4: 133,994,265 T74A probably damaging Het
Dio3 G A 12: 110,279,557 C109Y possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Efcab3 A T 11: 105,117,080 T329S possibly damaging Het
Esp1 A T 17: 40,728,856 I11L probably benign Het
Fam13b A T 18: 34,498,026 H33Q possibly damaging Het
Fam13c G A 10: 70,554,525 D539N probably damaging Het
Fgd5 A G 6: 91,988,030 T257A probably benign Het
Gm5134 A G 10: 76,008,619 D603G probably benign Het
Gtpbp2 T C 17: 46,168,276 V588A probably benign Het
Ift140 A G 17: 25,033,116 I312M probably benign Het
Inpp5j T C 11: 3,500,640 N571S probably damaging Het
Iqgap1 T G 7: 80,723,822 D1473A probably benign Het
Ivl T G 3: 92,571,387 K457T unknown Het
Kdm3b T C 18: 34,793,005 I66T probably damaging Het
Kif21a A T 15: 90,940,446 M1430K probably damaging Het
Klhl25 T A 7: 75,865,991 L215Q possibly damaging Het
Lim2 T A 7: 43,435,675 M163K probably benign Het
Lrig1 T C 6: 94,626,405 D254G probably damaging Het
Mff A G 1: 82,751,666 I122V possibly damaging Het
Mrpl15 A C 1: 4,782,566 probably null Het
Mylk A G 16: 34,929,888 Y1199C possibly damaging Het
Nlrp3 G A 11: 59,565,192 C938Y probably damaging Het
Notch1 T C 2: 26,478,106 N623D probably damaging Het
Obscn T G 11: 59,054,998 E4129A probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1423 A G 19: 12,036,275 S156P probably damaging Het
Olfr173 T C 16: 58,797,432 K138R probably benign Het
Olfr517 A T 7: 108,868,588 C189S probably damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Parm1 C T 5: 91,622,997 P291S probably damaging Het
Pcsk1 T A 13: 75,093,069 probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Piezo1 T G 8: 122,507,627 Q93H probably benign Het
Pkd2l2 A T 18: 34,438,157 Y575F probably damaging Het
Plekhn1 A C 4: 156,224,569 F258C probably damaging Het
Pole C T 5: 110,323,616 H1409Y probably benign Het
Rae1 T C 2: 173,012,248 I273T probably damaging Het
Rag1 A G 2: 101,643,645 V384A probably damaging Het
Rnaseh1 T C 12: 28,649,762 L25P probably damaging Het
Serpinb12 A G 1: 106,949,158 H68R probably benign Het
Sh3tc2 A T 18: 61,977,954 I294F probably damaging Het
Sirpb1b A C 3: 15,548,798 L75V possibly damaging Het
Slc12a6 A T 2: 112,337,942 T277S probably damaging Het
Slc7a12 A T 3: 14,499,197 E43D probably benign Het
Spata31d1c T A 13: 65,035,944 D433E probably benign Het
Tbl2 A T 5: 135,159,276 Y308F probably damaging Het
Tfec T C 6: 16,835,302 Y159C probably damaging Het
Tmem8 C A 17: 26,120,636 T616N probably damaging Het
Top1mt G T 15: 75,667,433 T371K probably benign Het
Trim24 T C 6: 37,951,468 V541A probably benign Het
Ttc16 T C 2: 32,768,037 Y456C possibly damaging Het
Ttn G A 2: 76,770,097 R17204* probably null Het
Ugt1a6b T C 1: 88,107,717 V259A probably benign Het
Vmn1r63 T A 7: 5,802,949 H228L probably damaging Het
Whamm G T 7: 81,596,120 V775F probably damaging Het
Zfc3h1 T A 10: 115,420,733 I1536N probably benign Het
Zfp1 T C 8: 111,670,339 S317P probably damaging Het
Zfp58 T C 13: 67,494,073 T52A probably damaging Het
Other mutations in Unc5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Unc5a APN 13 54995820 missense probably benign 0.00
IGL00339:Unc5a APN 13 54995815 missense possibly damaging 0.89
IGL00924:Unc5a APN 13 55004514 missense probably damaging 0.99
IGL01411:Unc5a APN 13 55002928 missense probably damaging 1.00
IGL01511:Unc5a APN 13 55004816 missense probably damaging 0.97
IGL02430:Unc5a APN 13 55002482 missense probably damaging 1.00
IGL02996:Unc5a APN 13 54996178 missense probably damaging 0.99
IGL03188:Unc5a APN 13 54999503 missense probably damaging 0.98
PIT1430001:Unc5a UTSW 13 55003896 missense probably damaging 1.00
PIT4378001:Unc5a UTSW 13 54995868 missense possibly damaging 0.95
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0028:Unc5a UTSW 13 55003913 missense possibly damaging 0.70
R0505:Unc5a UTSW 13 55004954 missense probably damaging 1.00
R0744:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R0745:Unc5a UTSW 13 55005255 frame shift probably null
R0836:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R1018:Unc5a UTSW 13 54990952 missense possibly damaging 0.81
R1432:Unc5a UTSW 13 55004472 unclassified probably benign
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1691:Unc5a UTSW 13 55002924 missense probably damaging 1.00
R2132:Unc5a UTSW 13 54991083 missense probably damaging 0.96
R4020:Unc5a UTSW 13 55003369 missense probably damaging 1.00
R4080:Unc5a UTSW 13 55004481 missense possibly damaging 0.62
R4720:Unc5a UTSW 13 55003883 missense probably null 1.00
R4876:Unc5a UTSW 13 54997229 missense probably benign
R4953:Unc5a UTSW 13 54999870 missense probably benign 0.02
R5112:Unc5a UTSW 13 55003418 critical splice donor site probably null
R5593:Unc5a UTSW 13 55004934 missense possibly damaging 0.91
R5903:Unc5a UTSW 13 54999690 missense possibly damaging 0.92
R6521:Unc5a UTSW 13 55004935 missense probably benign 0.01
R7038:Unc5a UTSW 13 55004484 missense probably damaging 1.00
R7065:Unc5a UTSW 13 54991083 missense probably damaging 1.00
R7241:Unc5a UTSW 13 54991020 missense probably damaging 1.00
R7365:Unc5a UTSW 13 54996573 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCACAGGGTCTATAAGCTGCTG -3'
(R):5'- TGCAGACGTCATGACACACG -3'

Sequencing Primer
(F):5'- CAGGGTCTATAAGCTGCTGTAGGTG -3'
(R):5'- CACCATGTGCATTGAGGAGTG -3'
Posted On2018-08-01