Incidental Mutation 'R6723:Pi4ka'
ID529717
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6723 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17376982 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 184 (L184P)
Ref Sequence ENSEMBL: ENSMUSP00000036162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000232232]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036161
AA Change: L184P

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: L184P

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: L184P

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232232
AA Change: L184P
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,823 Y2451C possibly damaging Het
Ahnak2 A G 12: 112,778,793 S740P probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bcl11a C A 11: 24,163,646 P330T probably damaging Het
Cyp2d12 A T 15: 82,556,884 I124F probably benign Het
Dhdds T C 4: 133,994,265 T74A probably damaging Het
Dio3 G A 12: 110,279,557 C109Y possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Efcab3 A T 11: 105,117,080 T329S possibly damaging Het
Esp1 A T 17: 40,728,856 I11L probably benign Het
Fam13b A T 18: 34,498,026 H33Q possibly damaging Het
Fam13c G A 10: 70,554,525 D539N probably damaging Het
Fgd5 A G 6: 91,988,030 T257A probably benign Het
Gm5134 A G 10: 76,008,619 D603G probably benign Het
Gtpbp2 T C 17: 46,168,276 V588A probably benign Het
Ift140 A G 17: 25,033,116 I312M probably benign Het
Inpp5j T C 11: 3,500,640 N571S probably damaging Het
Iqgap1 T G 7: 80,723,822 D1473A probably benign Het
Ivl T G 3: 92,571,387 K457T unknown Het
Kdm3b T C 18: 34,793,005 I66T probably damaging Het
Kif21a A T 15: 90,940,446 M1430K probably damaging Het
Klhl25 T A 7: 75,865,991 L215Q possibly damaging Het
Lim2 T A 7: 43,435,675 M163K probably benign Het
Lrig1 T C 6: 94,626,405 D254G probably damaging Het
Mff A G 1: 82,751,666 I122V possibly damaging Het
Mrpl15 A C 1: 4,782,566 probably null Het
Mylk A G 16: 34,929,888 Y1199C possibly damaging Het
Nlrp3 G A 11: 59,565,192 C938Y probably damaging Het
Notch1 T C 2: 26,478,106 N623D probably damaging Het
Obscn T G 11: 59,054,998 E4129A probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1423 A G 19: 12,036,275 S156P probably damaging Het
Olfr173 T C 16: 58,797,432 K138R probably benign Het
Olfr517 A T 7: 108,868,588 C189S probably damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Parm1 C T 5: 91,622,997 P291S probably damaging Het
Pcsk1 T A 13: 75,093,069 probably null Het
Piezo1 T G 8: 122,507,627 Q93H probably benign Het
Pkd2l2 A T 18: 34,438,157 Y575F probably damaging Het
Plekhn1 A C 4: 156,224,569 F258C probably damaging Het
Pole C T 5: 110,323,616 H1409Y probably benign Het
Rae1 T C 2: 173,012,248 I273T probably damaging Het
Rag1 A G 2: 101,643,645 V384A probably damaging Het
Rnaseh1 T C 12: 28,649,762 L25P probably damaging Het
Serpinb12 A G 1: 106,949,158 H68R probably benign Het
Sh3tc2 A T 18: 61,977,954 I294F probably damaging Het
Sirpb1b A C 3: 15,548,798 L75V possibly damaging Het
Slc12a6 A T 2: 112,337,942 T277S probably damaging Het
Slc7a12 A T 3: 14,499,197 E43D probably benign Het
Spata31d1c T A 13: 65,035,944 D433E probably benign Het
Tbl2 A T 5: 135,159,276 Y308F probably damaging Het
Tfec T C 6: 16,835,302 Y159C probably damaging Het
Tmem8 C A 17: 26,120,636 T616N probably damaging Het
Top1mt G T 15: 75,667,433 T371K probably benign Het
Trim24 T C 6: 37,951,468 V541A probably benign Het
Ttc16 T C 2: 32,768,037 Y456C possibly damaging Het
Ttn G A 2: 76,770,097 R17204* probably null Het
Ugt1a6b T C 1: 88,107,717 V259A probably benign Het
Unc5a T C 13: 54,995,889 W129R probably benign Het
Vmn1r63 T A 7: 5,802,949 H228L probably damaging Het
Whamm G T 7: 81,596,120 V775F probably damaging Het
Zfc3h1 T A 10: 115,420,733 I1536N probably benign Het
Zfp1 T C 8: 111,670,339 S317P probably damaging Het
Zfp58 T C 13: 67,494,073 T52A probably damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTACAGAGTGAGACCCTTTC -3'
(R):5'- TGCGATCCCATGCCTGATAG -3'

Sequencing Primer
(F):5'- CTTGCATGGGTGCTTACT -3'
(R):5'- GATCCCATGCCTGATAGGAATCTC -3'
Posted On2018-08-01