Incidental Mutation 'R6724:Olfr1245'
ID529740
Institutional Source Beutler Lab
Gene Symbol Olfr1245
Ensembl Gene ENSMUSG00000111456
Gene Nameolfactory receptor 1245
SynonymsGA_x6K02T2Q125-51020951-51020028, MOR231-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6724 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89573406-89578447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89574965 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 254 (F254I)
Ref Sequence ENSEMBL: ENSMUSP00000150791 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000214870
AA Change: F254I

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217402
AA Change: F254I

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Csmd2 A G 4: 128,563,371 I3544V probably damaging Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Dtnb T A 12: 3,686,817 V319D probably damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gcn1l1 T G 5: 115,609,158 probably null Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Klra5 T A 6: 129,906,680 K71N probably benign Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ppp2r3c A T 12: 55,288,496 S261T probably benign Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Tacc2 A G 7: 130,728,762 R259G probably damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Tpcn2 G A 7: 145,256,520 A649V probably benign Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Wdr6 G A 9: 108,574,894 H597Y probably benign Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Olfr1245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Olfr1245 APN 2 89575423 missense possibly damaging 0.68
IGL01690:Olfr1245 APN 2 89575213 missense probably benign 0.09
IGL02334:Olfr1245 APN 2 89575324 missense possibly damaging 0.95
IGL02435:Olfr1245 APN 2 89575546 missense probably damaging 0.99
IGL02793:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL02875:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL03218:Olfr1245 APN 2 89575591 missense probably benign 0.09
IGL03392:Olfr1245 APN 2 89575249 missense probably damaging 0.96
H8786:Olfr1245 UTSW 2 89575279 missense probably damaging 1.00
I0000:Olfr1245 UTSW 2 89575153 missense probably damaging 1.00
R0044:Olfr1245 UTSW 2 89575630 missense possibly damaging 0.68
R0190:Olfr1245 UTSW 2 89574958 missense probably damaging 0.98
R1585:Olfr1245 UTSW 2 89575402 missense possibly damaging 0.89
R1902:Olfr1245 UTSW 2 89575603 missense possibly damaging 0.77
R2018:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2019:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2020:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2021:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2030:Olfr1245 UTSW 2 89575214 missense probably benign 0.00
R2133:Olfr1245 UTSW 2 89575256 nonsense probably null
R3850:Olfr1245 UTSW 2 89575034 missense probably damaging 0.99
R4066:Olfr1245 UTSW 2 89575179 missense probably damaging 1.00
R4754:Olfr1245 UTSW 2 89575047 missense probably benign
R4923:Olfr1245 UTSW 2 89575679 missense probably damaging 0.98
R5303:Olfr1245 UTSW 2 89575001 missense possibly damaging 0.88
R5574:Olfr1245 UTSW 2 89574977 missense possibly damaging 0.94
R6083:Olfr1245 UTSW 2 89575672 missense probably benign 0.42
R6188:Olfr1245 UTSW 2 89575194 nonsense probably null
R6964:Olfr1245 UTSW 2 89574989 missense probably benign
R7066:Olfr1245 UTSW 2 89575703 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGCAATGGACAAGACCACAC -3'
(R):5'- TGGCCTCACTGTTATTGCTAATG -3'

Sequencing Primer
(F):5'- GACCACACACCCTTTGTTTATAAC -3'
(R):5'- CACTGTTATTGCTAATGGTGGAGCC -3'
Posted On2018-08-01