Incidental Mutation 'R6726:Rab3gap2'
ID529849
Institutional Source Beutler Lab
Gene Symbol Rab3gap2
Ensembl Gene ENSMUSG00000039318
Gene NameRAB3 GTPase activating protein subunit 2
Synonyms1110059F07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location185204117-185286759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 185247865 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 327 (S327A)
Ref Sequence ENSEMBL: ENSMUSP00000141608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069652
AA Change: S327A

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: S327A

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-167 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 767 1366 3.2e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193245
Predicted Effect probably damaging
Transcript: ENSMUST00000194740
AA Change: S327A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318
AA Change: S327A

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-157 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 766 1346 2.5e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196796
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Rab3gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Rab3gap2 APN 1 185238870 missense probably damaging 1.00
IGL01620:Rab3gap2 APN 1 185204326 missense probably benign
IGL01977:Rab3gap2 APN 1 185267023 nonsense probably null
IGL02183:Rab3gap2 APN 1 185271468 nonsense probably null
IGL02229:Rab3gap2 APN 1 185259383 missense possibly damaging 0.71
IGL02231:Rab3gap2 APN 1 185266898 splice site probably benign
IGL02506:Rab3gap2 APN 1 185252024 splice site probably benign
IGL02618:Rab3gap2 APN 1 185251741 missense possibly damaging 0.79
IGL02643:Rab3gap2 APN 1 185267000 missense possibly damaging 0.69
IGL03239:Rab3gap2 APN 1 185249894 missense probably damaging 1.00
PIT4498001:Rab3gap2 UTSW 1 185281685 missense probably damaging 1.00
R0173:Rab3gap2 UTSW 1 185249907 missense possibly damaging 0.51
R0372:Rab3gap2 UTSW 1 185262694 missense possibly damaging 0.93
R0492:Rab3gap2 UTSW 1 185252392 splice site probably benign
R0510:Rab3gap2 UTSW 1 185260508 splice site probably benign
R0708:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R0711:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R1135:Rab3gap2 UTSW 1 185275943 missense possibly damaging 0.95
R1428:Rab3gap2 UTSW 1 185247904 missense probably damaging 1.00
R1599:Rab3gap2 UTSW 1 185251026 missense probably benign 0.07
R1758:Rab3gap2 UTSW 1 185283884 missense probably benign 0.13
R1903:Rab3gap2 UTSW 1 185221902 missense probably benign
R1929:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R1994:Rab3gap2 UTSW 1 185236024 missense probably damaging 1.00
R2010:Rab3gap2 UTSW 1 185278281 missense possibly damaging 0.57
R2102:Rab3gap2 UTSW 1 185282389 missense probably benign 0.00
R2120:Rab3gap2 UTSW 1 185261367 missense possibly damaging 0.95
R2219:Rab3gap2 UTSW 1 185275916 missense probably damaging 0.99
R2259:Rab3gap2 UTSW 1 185221859 missense probably damaging 1.00
R2270:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R2272:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R3083:Rab3gap2 UTSW 1 185204269 missense probably benign 0.00
R3776:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R4050:Rab3gap2 UTSW 1 185272643 critical splice donor site probably null
R4130:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R4176:Rab3gap2 UTSW 1 185246666 missense probably damaging 0.99
R4296:Rab3gap2 UTSW 1 185255837 critical splice donor site probably null
R4416:Rab3gap2 UTSW 1 185282347 missense probably benign 0.00
R4426:Rab3gap2 UTSW 1 185235342 missense probably damaging 1.00
R4516:Rab3gap2 UTSW 1 185267068 missense probably benign
R4518:Rab3gap2 UTSW 1 185267068 missense probably benign
R4891:Rab3gap2 UTSW 1 185259366 missense probably benign 0.00
R4913:Rab3gap2 UTSW 1 185262829 missense probably benign 0.12
R4955:Rab3gap2 UTSW 1 185267155 intron probably benign
R5411:Rab3gap2 UTSW 1 185277145 critical splice acceptor site probably null
R5516:Rab3gap2 UTSW 1 185235487 missense probably benign 0.02
R5670:Rab3gap2 UTSW 1 185221899 missense probably benign
R5670:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R6380:Rab3gap2 UTSW 1 185235984 missense probably damaging 1.00
R6533:Rab3gap2 UTSW 1 185232954 splice site probably null
R6655:Rab3gap2 UTSW 1 185250011 missense probably damaging 1.00
R6676:Rab3gap2 UTSW 1 185283410 missense probably damaging 1.00
R6969:Rab3gap2 UTSW 1 185236012 missense probably damaging 1.00
R7151:Rab3gap2 UTSW 1 185248053 missense probably benign 0.00
R7168:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R7196:Rab3gap2 UTSW 1 185281667 missense probably damaging 1.00
R7201:Rab3gap2 UTSW 1 185267191 missense probably damaging 1.00
Z1088:Rab3gap2 UTSW 1 185281677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGAGGCCAAAGTACTGAC -3'
(R):5'- TGGACAGTGTCTTCCTCATGC -3'

Sequencing Primer
(F):5'- CAGGAGCAACTTGTGGGTTCAC -3'
(R):5'- ATGCTTGCTTTTCCAACCAAG -3'
Posted On2018-08-01