Incidental Mutation 'R6726:Olfr1015'
ID529852
Institutional Source Beutler Lab
Gene Symbol Olfr1015
Ensembl Gene ENSMUSG00000033850
Gene Nameolfactory receptor 1015
SynonymsGA_x6K02T2Q125-47264151-47265089, MOR213-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85782017-85787812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85785562 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 17 (F17S)
Ref Sequence ENSEMBL: ENSMUSP00000148957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047870] [ENSMUST00000215945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047870
AA Change: F17S

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046301
Gene: ENSMUSG00000033850
AA Change: F17S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.5e-49 PFAM
Pfam:7tm_1 41 290 4.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214726
Predicted Effect possibly damaging
Transcript: ENSMUST00000215945
AA Change: F17S

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Olfr1015
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Olfr1015 APN 2 85786117 missense probably benign 0.21
IGL01716:Olfr1015 APN 2 85786143 missense probably damaging 0.97
IGL03196:Olfr1015 APN 2 85786021 missense possibly damaging 0.63
IGL03374:Olfr1015 APN 2 85785709 missense probably damaging 1.00
R0329:Olfr1015 UTSW 2 85785803 nonsense probably null
R0330:Olfr1015 UTSW 2 85785803 nonsense probably null
R0714:Olfr1015 UTSW 2 85786399 missense probably damaging 1.00
R0965:Olfr1015 UTSW 2 85786299 missense probably damaging 1.00
R1078:Olfr1015 UTSW 2 85786093 missense possibly damaging 0.53
R3826:Olfr1015 UTSW 2 85786215 nonsense probably null
R5031:Olfr1015 UTSW 2 85785718 nonsense probably null
R5239:Olfr1015 UTSW 2 85785658 missense probably damaging 1.00
R6120:Olfr1015 UTSW 2 85786341 missense probably damaging 1.00
R6177:Olfr1015 UTSW 2 85785660 missense probably damaging 0.99
R6954:Olfr1015 UTSW 2 85786382 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACATCATGTTATTCAGGTCCAG -3'
(R):5'- TAGCACTCAGTGTAGGCTGC -3'

Sequencing Primer
(F):5'- TCATGTTATTCAGGTCCAGTATTTG -3'
(R):5'- GCTTATCCTCTGAAACACAGTTGAC -3'
Posted On2018-08-01