Incidental Mutation 'R6726:Ckap2l'
ID529853
Institutional Source Beutler Lab
Gene Symbol Ckap2l
Ensembl Gene ENSMUSG00000048327
Gene Namecytoskeleton associated protein 2-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129268210-129297212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129269194 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 694 (E694D)
Ref Sequence ENSEMBL: ENSMUSP00000056145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052708]
Predicted Effect probably damaging
Transcript: ENSMUST00000052708
AA Change: E694D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327
AA Change: E694D

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:CKAP2_C 425 644 3e-32 PFAM
Pfam:CKAP2_C 675 734 6.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141964
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a mitotic spindle protein important to neural stem or progenitor cells. Mutations in this gene have been associated with spindle organization defects, including mitotic spindle defects, lagging chromosomes, and chromatin bridges. There is evidence that mutations in this gene are associated with Filippi syndrome, characterized by growth defects, microcephaly, intellectual disability, facial feature defects, and syndactyly. There is a pseudogene of this gene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Ckap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Ckap2l APN 2 129269216 missense probably damaging 1.00
IGL02120:Ckap2l APN 2 129285622 missense possibly damaging 0.58
IGL03085:Ckap2l APN 2 129285047 missense probably benign 0.00
IGL03175:Ckap2l APN 2 129285517 missense probably benign 0.01
IGL03333:Ckap2l APN 2 129296308 splice site probably null
R0196:Ckap2l UTSW 2 129285422 missense probably benign 0.43
R0501:Ckap2l UTSW 2 129285491 missense possibly damaging 0.78
R0715:Ckap2l UTSW 2 129285716 missense probably benign 0.02
R0834:Ckap2l UTSW 2 129296304 splice site probably benign
R1119:Ckap2l UTSW 2 129272572 splice site probably benign
R1561:Ckap2l UTSW 2 129270725 missense probably benign 0.01
R1677:Ckap2l UTSW 2 129285167 missense possibly damaging 0.86
R1823:Ckap2l UTSW 2 129275579 missense probably damaging 1.00
R1971:Ckap2l UTSW 2 129285422 missense possibly damaging 0.92
R4803:Ckap2l UTSW 2 129269256 missense probably damaging 1.00
R5214:Ckap2l UTSW 2 129285469 missense probably benign 0.02
R5264:Ckap2l UTSW 2 129285379 missense probably benign 0.01
R5297:Ckap2l UTSW 2 129285370 missense possibly damaging 0.56
R5535:Ckap2l UTSW 2 129285842 missense probably benign 0.00
R5606:Ckap2l UTSW 2 129286039 missense probably damaging 0.98
R6327:Ckap2l UTSW 2 129285494 missense probably damaging 1.00
R6489:Ckap2l UTSW 2 129269114 missense possibly damaging 0.85
R7199:Ckap2l UTSW 2 129285055 missense probably benign 0.25
R7220:Ckap2l UTSW 2 129275516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTTATGTCTTGCAAGCTC -3'
(R):5'- CTCACACTGAAGTACCAGCTATG -3'

Sequencing Primer
(F):5'- GACTTCAAAGCCCAGTGT -3'
(R):5'- ACTGAAGTACCAGCTATGCATAAG -3'
Posted On2018-08-01