Incidental Mutation 'R6726:Acot11'
ID529856
Institutional Source Beutler Lab
Gene Symbol Acot11
Ensembl Gene ENSMUSG00000034853
Gene Nameacyl-CoA thioesterase 11
SynonymsThea, Them1, 2010309H15Rik, 1110020M10Rik, BFIT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106744555-106804998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106760130 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 240 (G240R)
Ref Sequence ENSEMBL: ENSMUSP00000099823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541] [ENSMUST00000145061] [ENSMUST00000148688] [ENSMUST00000156567]
Predicted Effect probably damaging
Transcript: ENSMUST00000065253
AA Change: G260R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853
AA Change: G260R

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102762
AA Change: G240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853
AA Change: G240R

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144809
Predicted Effect probably benign
Transcript: ENSMUST00000145061
SMART Domains Protein: ENSMUSP00000125123
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 49 107 4.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148688
SMART Domains Protein: ENSMUSP00000124385
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 28 93 6e-23 PDB
SCOP:d1lo7a_ 33 93 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156567
SMART Domains Protein: ENSMUSP00000123942
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 43 89 8e-11 PDB
SCOP:d1lo7a_ 48 80 2e-3 SMART
Meta Mutation Damage Score 0.6 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA thioesterase family which catalyse the conversion of activated fatty acids to the corresponding non-esterified fatty acid and coenzyme A. Expression of a mouse homolog in brown adipose tissue is induced by low temperatures and repressed by warm temperatures. Higher levels of expression of the mouse homolog has been found in obesity-resistant mice compared with obesity-prone mice, suggesting a role of acyl-CoA thioesterase 11 in obesity. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null mutation display resistance to high fat diet induced obesity, inflammation and hepatic steatosis, increased energy expenditure, increased brown adipose tissue amount, and increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Acot11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Acot11 APN 4 106771484 missense probably benign 0.00
IGL01896:Acot11 APN 4 106771367 missense probably damaging 1.00
IGL02408:Acot11 APN 4 106758381 missense probably damaging 1.00
IGL03053:Acot11 APN 4 106755853 nonsense probably null
IGL03156:Acot11 APN 4 106754136 missense probably damaging 1.00
R0266:Acot11 UTSW 4 106749988 missense probably damaging 0.99
R0485:Acot11 UTSW 4 106762027 missense probably damaging 1.00
R0537:Acot11 UTSW 4 106762455 missense probably benign 0.10
R0707:Acot11 UTSW 4 106760132 missense probably damaging 1.00
R0969:Acot11 UTSW 4 106760080 critical splice donor site probably null
R1109:Acot11 UTSW 4 106749348 missense probably benign 0.01
R1785:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1786:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1965:Acot11 UTSW 4 106749353 missense probably damaging 1.00
R2076:Acot11 UTSW 4 106770713 missense probably damaging 0.99
R2509:Acot11 UTSW 4 106755319 missense possibly damaging 0.90
R4558:Acot11 UTSW 4 106748366 missense probably damaging 1.00
R4565:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4567:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4847:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4881:Acot11 UTSW 4 106755305 critical splice donor site probably null
R5234:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5235:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5409:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5430:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5518:Acot11 UTSW 4 106750010 missense probably benign 0.24
R5763:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5787:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5788:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5933:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5934:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6093:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6104:Acot11 UTSW 4 106755897 missense probably damaging 1.00
R6727:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6728:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6734:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R7242:Acot11 UTSW 4 106762493 missense probably benign 0.00
R7257:Acot11 UTSW 4 106758402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGAGGTGTGGAAATCTAGGG -3'
(R):5'- TGTCATTGTCCCAGGGCTTC -3'

Sequencing Primer
(F):5'- TAGGGTTCTCCTAGCAGAGCAC -3'
(R):5'- CCATGGACAGTCTATCCTTAGGG -3'
Posted On2018-08-01