Incidental Mutation 'R6726:Prkab1'
ID529858
Institutional Source Beutler Lab
Gene Symbol Prkab1
Ensembl Gene ENSMUSG00000029513
Gene Nameprotein kinase, AMP-activated, beta 1 non-catalytic subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location116013586-116024508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116020033 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 168 (V168A)
Ref Sequence ENSEMBL: ENSMUSP00000107630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031486] [ENSMUST00000111999] [ENSMUST00000133098] [ENSMUST00000148208]
Predicted Effect probably benign
Transcript: ENSMUST00000031486
AA Change: V168A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031486
Gene: ENSMUSG00000029513
AA Change: V168A

DomainStartEndE-ValueType
Pfam:AMPK1_CBM 78 161 3e-37 PFAM
AMPKBI 180 270 4.04e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111999
AA Change: V168A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107630
Gene: ENSMUSG00000029513
AA Change: V168A

DomainStartEndE-ValueType
AMPKBI 180 270 4.04e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127049
Predicted Effect probably benign
Transcript: ENSMUST00000133098
SMART Domains Protein: ENSMUSP00000138749
Gene: ENSMUSG00000029513

DomainStartEndE-ValueType
PDB:4CFF|D 1 139 4e-97 PDB
Blast:AMPKBI 90 139 2e-29 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147343
Predicted Effect probably benign
Transcript: ENSMUST00000148208
SMART Domains Protein: ENSMUSP00000138221
Gene: ENSMUSG00000029513

DomainStartEndE-ValueType
PDB:4CFF|D 1 139 4e-97 PDB
Blast:AMPKBI 90 139 2e-29 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152174
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator of AMPK activity. The myristoylation and phosphorylation of this subunit have been shown to affect the enzyme activity and cellular localization of AMPK. This subunit may also serve as an adaptor molecule mediating the association of the AMPK complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele exhibit altered brain development, seizures, and postnatal death. Homozygotes for a null allele are protected from diet-induced obesity and hepatic insulin resistance. Homozygotes for another null allele show microcytic anemia and extramedullary hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Prkab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Prkab1 APN 5 116024110 missense probably damaging 1.00
IGL01730:Prkab1 APN 5 116021492 missense probably damaging 1.00
R0145:Prkab1 UTSW 5 116018085 splice site probably benign
R0233:Prkab1 UTSW 5 116021652 splice site probably benign
R2295:Prkab1 UTSW 5 116021656 splice site probably null
R5845:Prkab1 UTSW 5 116024160 missense probably benign 0.00
X0062:Prkab1 UTSW 5 116021512 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGGTTAAACTCCAACAGCCAGG -3'
(R):5'- AAGAGTCGCTAACCAGGCAG -3'

Sequencing Primer
(F):5'- CCACTGGAATTAGGAAGGAACTGC -3'
(R):5'- TCGCTAACCAGGCAGTGAGG -3'
Posted On2018-08-01