Incidental Mutation 'R6726:Atp6v1e1'
ID529860
Institutional Source Beutler Lab
Gene Symbol Atp6v1e1
Ensembl Gene ENSMUSG00000019210
Gene NameATPase, H+ transporting, lysosomal V1 subunit E1
Synonyms2410029D23Rik, E2, Atp6e2, Atp6e, H+ ATPase subunit E, H(+)-ATPase E-like protein, Atp6v1e, lysosomal 31kDa, D6Ertd385e
MMRRC Submission
Accession Numbers

Genbank: NM_007510; MGI: 894326 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location120794305-120822793 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 120804050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019354] [ENSMUST00000203783] [ENSMUST00000204699] [ENSMUST00000205049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019354
AA Change: V120D

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019354
Gene: ENSMUSG00000019210
AA Change: V120D

DomainStartEndE-ValueType
Pfam:vATP-synt_E 18 216 7.6e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203527
Predicted Effect probably null
Transcript: ENSMUST00000203783
SMART Domains Protein: ENSMUSP00000145324
Gene: ENSMUSG00000019210

DomainStartEndE-ValueType
Pfam:vATP-synt_E 7 118 2.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204699
SMART Domains Protein: ENSMUSP00000145437
Gene: ENSMUSG00000019210

DomainStartEndE-ValueType
Pfam:vATP-synt_E 4 78 4.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205049
SMART Domains Protein: ENSMUSP00000145353
Gene: ENSMUSG00000019210

DomainStartEndE-ValueType
Pfam:vATP-synt_E 5 87 1e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain E subunit isoforms. Pseudogenes for this gene have been found in the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Atp6v1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Atp6v1e1 APN 6 120808411 missense possibly damaging 0.92
IGL01387:Atp6v1e1 APN 6 120795771 unclassified probably null
IGL01447:Atp6v1e1 APN 6 120795693 utr 3 prime probably benign
IGL02372:Atp6v1e1 APN 6 120801123 missense probably benign 0.00
R0595:Atp6v1e1 UTSW 6 120801130 missense probably benign 0.02
R3801:Atp6v1e1 UTSW 6 120801059 missense probably benign 0.02
R4897:Atp6v1e1 UTSW 6 120804083 missense probably null 0.88
R5291:Atp6v1e1 UTSW 6 120818333 critical splice donor site probably null
R5690:Atp6v1e1 UTSW 6 120808356 splice site probably null
R7080:Atp6v1e1 UTSW 6 120822389 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAGGCAGGTAGATTTAACTAG -3'
(R):5'- GTGAGGACATACGCTGGATG -3'

Sequencing Primer
(F):5'- AGGAAATAGTATGACACTTTCAAGTC -3'
(R):5'- ACATACGCTGGATGGGTGGC -3'
Posted On2018-08-01