Incidental Mutation 'R6726:Gm5737'
ID529863
Institutional Source Beutler Lab
Gene Symbol Gm5737
Ensembl Gene ENSMUSG00000109392
Gene Namepredicted gene 5737
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120812365-120831193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120826109 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 308 (S308P)
Ref Sequence ENSEMBL: ENSMUSP00000146629 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208668
AA Change: S308P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Gm5737
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7147:Gm5737 UTSW 7 120813015 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGATCAAGGAATAGATTGGTGTG -3'
(R):5'- TCGAGACATTTGCCCCTCTG -3'

Sequencing Primer
(F):5'- CTTGATTCCAGCACTCAAGAGGTAG -3'
(R):5'- CTCTGCGTGCAGGGTCTG -3'
Posted On2018-08-01