Incidental Mutation 'R6726:Ufsp2'
ID529867
Institutional Source Beutler Lab
Gene Symbol Ufsp2
Ensembl Gene ENSMUSG00000031634
Gene NameUFM1-specific peptidase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location45975528-45996958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45985467 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 194 (M194T)
Ref Sequence ENSEMBL: ENSMUSP00000147993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034051] [ENSMUST00000123307] [ENSMUST00000130412] [ENSMUST00000209443] [ENSMUST00000210081]
Predicted Effect probably benign
Transcript: ENSMUST00000034051
AA Change: M269T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034051
Gene: ENSMUSG00000031634
AA Change: M269T

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
Pfam:Peptidase_C78 268 453 1.3e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123041
Predicted Effect probably benign
Transcript: ENSMUST00000123307
Predicted Effect probably benign
Transcript: ENSMUST00000130412
Predicted Effect probably benign
Transcript: ENSMUST00000209443
AA Change: M194T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000210081
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cysteine protease. The protein cleaves two C-terminal residues from ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein. Activation of ubiquitin-fold modifier 1 by the encoded protein exposes a C-terminal glycine residue that allows interaction with other proteins and transfer to its target protein. An allelic variant of this gene has been associated with Beukes hip dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Ufsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Ufsp2 APN 8 45995664 critical splice donor site probably null
IGL02122:Ufsp2 APN 8 45995648 missense probably benign 0.01
IGL02523:Ufsp2 APN 8 45983548 missense probably damaging 1.00
IGL03031:Ufsp2 APN 8 45984100 missense probably damaging 1.00
R0317:Ufsp2 UTSW 8 45992233 critical splice donor site probably null
R0523:Ufsp2 UTSW 8 45996743 missense probably benign 0.00
R0538:Ufsp2 UTSW 8 45992150 missense probably damaging 1.00
R0661:Ufsp2 UTSW 8 45979233 start codon destroyed probably null 1.00
R3927:Ufsp2 UTSW 8 45983686 splice site probably null
R4319:Ufsp2 UTSW 8 45995627 missense possibly damaging 0.95
R4355:Ufsp2 UTSW 8 45985465 missense possibly damaging 0.95
R5183:Ufsp2 UTSW 8 45994089 missense probably benign 0.18
R5473:Ufsp2 UTSW 8 45992221 missense probably damaging 1.00
R7133:Ufsp2 UTSW 8 45983624 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATTGACCTTAATGAATGAAGTCT -3'
(R):5'- ACCCACTAATTACACCTATCTTAAATG -3'

Sequencing Primer
(F):5'- ATTGTTTTCTTTGCCTATTGATTCTG -3'
(R):5'- ACTTGCTACGTAGACCAGGTTGAC -3'
Posted On2018-08-01