Incidental Mutation 'R6726:Dock3'
ID529873
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Namededicator of cyto-kinesis 3
SynonymsPBP, Moca
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106892825-107231909 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 107159452 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 42 (W42*)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
Predicted Effect probably null
Transcript: ENSMUST00000044532
AA Change: W42*
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: W42*

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169164
Meta Mutation Damage Score 0.552 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106911377 splice site probably benign
IGL01067:Dock3 APN 9 107082373 critical splice donor site probably null
IGL01160:Dock3 APN 9 106906688 missense probably damaging 1.00
IGL01290:Dock3 APN 9 106958400 splice site probably benign
IGL01291:Dock3 APN 9 106958400 splice site probably benign
IGL01391:Dock3 APN 9 106907234 missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106993471 missense probably benign 0.06
IGL01660:Dock3 APN 9 107032364 splice site probably benign
IGL01752:Dock3 APN 9 107025313 splice site probably benign
IGL01820:Dock3 APN 9 106895893 missense probably damaging 1.00
IGL01908:Dock3 APN 9 106906662 missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106938141 missense probably benign
IGL02227:Dock3 APN 9 107062055 missense probably damaging 0.98
IGL02309:Dock3 APN 9 106913152 missense probably damaging 1.00
IGL02408:Dock3 APN 9 106913099 splice site probably benign
IGL02469:Dock3 APN 9 106986016 missense probably damaging 0.98
IGL02545:Dock3 APN 9 107062072 missense probably damaging 1.00
IGL02894:Dock3 APN 9 106930099 missense probably benign 0.00
IGL02934:Dock3 APN 9 107023745 missense probably benign 0.01
IGL03027:Dock3 APN 9 106993478 missense probably damaging 0.98
IGL03068:Dock3 APN 9 106964759 missense possibly damaging 0.82
IGL03128:Dock3 APN 9 107032292 missense probably benign 0.05
IGL03161:Dock3 APN 9 107023788 missense probably damaging 0.99
IGL03263:Dock3 APN 9 106930131 splice site probably benign
IGL03279:Dock3 APN 9 106911248 splice site probably benign
IGL03366:Dock3 APN 9 107005433 missense probably benign 0.01
Implosion UTSW 9 106937926 missense probably benign 0.00
Tight UTSW 9 106994881 missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106895663 missense probably benign
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106912313 missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0206:Dock3 UTSW 9 106996996 nonsense probably null
R0208:Dock3 UTSW 9 106996996 nonsense probably null
R0384:Dock3 UTSW 9 106901895 splice site probably benign
R0610:Dock3 UTSW 9 107023788 missense probably damaging 0.99
R0731:Dock3 UTSW 9 106969856 missense probably damaging 1.00
R1184:Dock3 UTSW 9 106969800 missense probably damaging 1.00
R1350:Dock3 UTSW 9 106914632 missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106911349 missense probably damaging 1.00
R1424:Dock3 UTSW 9 106913193 missense probably damaging 1.00
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1539:Dock3 UTSW 9 106952364 missense probably damaging 1.00
R1539:Dock3 UTSW 9 106996913 missense probably benign 0.23
R1571:Dock3 UTSW 9 106937959 missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106973841 missense probably damaging 0.98
R1795:Dock3 UTSW 9 107025335 missense probably damaging 0.99
R1987:Dock3 UTSW 9 107108421 missense probably benign 0.01
R2000:Dock3 UTSW 9 106992961 splice site probably benign
R2074:Dock3 UTSW 9 106993463 missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106993544 missense probably benign 0.00
R2265:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2269:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2370:Dock3 UTSW 9 106952355 missense probably damaging 1.00
R2377:Dock3 UTSW 9 106895891 missense probably damaging 0.98
R2385:Dock3 UTSW 9 106991125 missense probably damaging 1.00
R2426:Dock3 UTSW 9 106914541 missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106941526 critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106911343 missense probably damaging 0.99
R4052:Dock3 UTSW 9 106973796 missense probably damaging 0.99
R4294:Dock3 UTSW 9 106930043 missense probably damaging 1.00
R4623:Dock3 UTSW 9 107062045 missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106993544 missense possibly damaging 0.71
R4705:Dock3 UTSW 9 107025336 missense probably damaging 1.00
R4771:Dock3 UTSW 9 106952358 missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106930067 missense probably damaging 1.00
R4898:Dock3 UTSW 9 106992972 missense possibly damaging 0.75
R4948:Dock3 UTSW 9 106991155 missense probably damaging 0.96
R4961:Dock3 UTSW 9 106941316 missense probably damaging 1.00
R4986:Dock3 UTSW 9 106931983 missense probably damaging 1.00
R5054:Dock3 UTSW 9 106937906 missense probably damaging 1.00
R5065:Dock3 UTSW 9 106955684 missense probably damaging 1.00
R5081:Dock3 UTSW 9 106991093 missense probably damaging 1.00
R5101:Dock3 UTSW 9 106969781 missense probably damaging 1.00
R5135:Dock3 UTSW 9 106932997 missense probably damaging 1.00
R5227:Dock3 UTSW 9 106986070 missense probably damaging 1.00
R5257:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5258:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5273:Dock3 UTSW 9 106900705 critical splice donor site probably null
R5322:Dock3 UTSW 9 106901829 missense probably benign 0.14
R5482:Dock3 UTSW 9 106978738 nonsense probably null
R5553:Dock3 UTSW 9 106991110 missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106955699 missense probably benign 0.01
R5739:Dock3 UTSW 9 106973796 missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106895488 missense possibly damaging 0.51
R5888:Dock3 UTSW 9 107023803 missense probably benign 0.12
R5960:Dock3 UTSW 9 106911355 nonsense probably null
R5974:Dock3 UTSW 9 106994062 missense probably damaging 1.00
R6116:Dock3 UTSW 9 106931962 missense probably damaging 1.00
R6162:Dock3 UTSW 9 106964799 missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6219:Dock3 UTSW 9 106994881 missense probably damaging 1.00
R6238:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6266:Dock3 UTSW 9 106964753 missense probably damaging 0.99
R6291:Dock3 UTSW 9 106908432 missense probably benign
R6531:Dock3 UTSW 9 106967216 missense probably benign
R6567:Dock3 UTSW 9 106896747 missense probably benign 0.13
R6572:Dock3 UTSW 9 106989475 missense probably damaging 0.99
R6620:Dock3 UTSW 9 106937926 missense probably benign 0.00
R7085:Dock3 UTSW 9 106901887 missense probably damaging 1.00
R7151:Dock3 UTSW 9 106964717 missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106895524 missense probably benign 0.20
X0023:Dock3 UTSW 9 106985998 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAGTCTGCCATAAATGTGACTG -3'
(R):5'- CTGCATTGGAGAGTGAGTCAGG -3'

Sequencing Primer
(F):5'- CTGCCATAAATGTGACTGTAGCTAC -3'
(R):5'- CAGGAAACAGTCTTGGCTATATTTCC -3'
Posted On2018-08-01