Incidental Mutation 'R6726:Serpina10'
ID529875
Institutional Source Beutler Lab
Gene Symbol Serpina10
Ensembl Gene ENSMUSG00000061947
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
SynonymsPZI
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location103614786-103631444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103628369 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 197 (I197K)
Ref Sequence ENSEMBL: ENSMUSP00000113644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044231] [ENSMUST00000121625]
Predicted Effect probably benign
Transcript: ENSMUST00000044231
AA Change: I197K

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048357
Gene: ENSMUSG00000061947
AA Change: I197K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 445 2.79e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121625
AA Change: I197K

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113644
Gene: ENSMUSG00000061947
AA Change: I197K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 391 3.12e-53 SMART
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large serpin family of proteins, and is also known as serpin PZ-dependent protease inhibitor (ZPI or PZI). This protein is thought to play an important role in the regulation of coagulation. It directly inhibits factor XIa, and also inhibits factor Xa in the presence of calcium, phospholipids, and protein Z (PZ). Deficiencies in this gene lead to an increase in thrombosis. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduced survival rate, enhanced thrombosis after ferric chloride-induced carotid artery injury, and increased mortality from pulmonary thromboembolism following collagen/epinephrine infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Serpina10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Serpina10 APN 12 103616949 missense probably damaging 1.00
IGL02411:Serpina10 APN 12 103616943 missense possibly damaging 0.94
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0526:Serpina10 UTSW 12 103616868 missense probably damaging 1.00
R1387:Serpina10 UTSW 12 103628241 missense probably benign
R1986:Serpina10 UTSW 12 103628255 missense possibly damaging 0.95
R2277:Serpina10 UTSW 12 103626743 missense probably benign 0.13
R4227:Serpina10 UTSW 12 103628415 missense probably damaging 0.99
R5237:Serpina10 UTSW 12 103628816 missense probably benign 0.39
R5506:Serpina10 UTSW 12 103626661 missense probably damaging 1.00
R6144:Serpina10 UTSW 12 103628833 missense probably benign 0.01
R6819:Serpina10 UTSW 12 103628360 missense probably benign 0.05
Y4337:Serpina10 UTSW 12 103624476 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTGCAGAGCATCCTTCAGTAC -3'
(R):5'- ATGGACTCAACCTACAGGCC -3'

Sequencing Primer
(F):5'- GCAGAGCATCCTTCAGTACTAAGTG -3'
(R):5'- TCAACCTACAGGCCCTGAG -3'
Posted On2018-08-01