Incidental Mutation 'R6726:Ptdss1'
ID529877
Institutional Source Beutler Lab
Gene Symbol Ptdss1
Ensembl Gene ENSMUSG00000021518
Gene Namephosphatidylserine synthase 1
SynonymsPSS-1, PtdSer Synthase-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location66932830-66998401 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 66953531 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 95 (R95*)
Ref Sequence ENSEMBL: ENSMUSP00000153371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021990] [ENSMUST00000224244] [ENSMUST00000224290]
Predicted Effect probably null
Transcript: ENSMUST00000021990
AA Change: R95*
SMART Domains Protein: ENSMUSP00000021990
Gene: ENSMUSG00000021518
AA Change: R95*

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 72 89 N/A INTRINSIC
Pfam:PSS 96 372 1.3e-108 PFAM
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224244
AA Change: S64L

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably null
Transcript: ENSMUST00000224290
AA Change: R95*
Predicted Effect unknown
Transcript: ENSMUST00000225347
AA Change: S19L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of phosphatidylserine from either phosphatidylcholine or phosphatidylethanolamine. Phosphatidylserine localizes to the mitochondria-associated membrane of the endoplasmic reticulum, where it serves a structural role as well as a signaling role. Defects in this gene are a cause of Lenz-Majewski hyperostotic dwarfism. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased phosphatidylethanolamine and phosphatidylserine levels in the liver but normal axon growth and life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Ptdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Ptdss1 APN 13 66987822 missense probably benign 0.02
IGL02798:Ptdss1 APN 13 66976760 missense probably damaging 1.00
IGL03114:Ptdss1 APN 13 66993994 nonsense probably null
R0344:Ptdss1 UTSW 13 66933572 missense probably damaging 1.00
R0591:Ptdss1 UTSW 13 66972650 splice site probably benign
R0749:Ptdss1 UTSW 13 66987850 nonsense probably null
R0759:Ptdss1 UTSW 13 66987804 missense probably damaging 1.00
R1140:Ptdss1 UTSW 13 66963356 missense probably benign 0.00
R1500:Ptdss1 UTSW 13 66995408 missense probably benign 0.04
R1676:Ptdss1 UTSW 13 66933637 missense probably damaging 1.00
R1761:Ptdss1 UTSW 13 66956412 missense possibly damaging 0.72
R2086:Ptdss1 UTSW 13 66953555 missense probably benign 0.00
R2087:Ptdss1 UTSW 13 66976817 splice site probably benign
R3962:Ptdss1 UTSW 13 66994011 missense probably benign 0.00
R4662:Ptdss1 UTSW 13 66933611 missense possibly damaging 0.95
R4707:Ptdss1 UTSW 13 66995418 critical splice donor site probably null
R4775:Ptdss1 UTSW 13 66987858 splice site probably null
R4993:Ptdss1 UTSW 13 66945288 missense probably benign 0.01
R5402:Ptdss1 UTSW 13 66933599 missense possibly damaging 0.88
R5463:Ptdss1 UTSW 13 66945301 missense probably damaging 1.00
R5643:Ptdss1 UTSW 13 66972540 missense probably damaging 1.00
R5644:Ptdss1 UTSW 13 66972540 missense probably damaging 1.00
R6043:Ptdss1 UTSW 13 66963369 missense probably damaging 1.00
R6145:Ptdss1 UTSW 13 66972637 critical splice donor site probably null
R7016:Ptdss1 UTSW 13 66972621 missense probably benign 0.00
R7116:Ptdss1 UTSW 13 66945327 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAGTTCAGCAAGGGCAAC -3'
(R):5'- GAGTTTATGCCATCACCAACC -3'

Sequencing Primer
(F):5'- CCAAAGGCAAAGTCCAGGCTATAG -3'
(R):5'- GGCACACTAAAAACGGTT -3'
Posted On2018-08-01