Incidental Mutation 'R6726:Sh3kbp1'
ID529888
Institutional Source Beutler Lab
Gene Symbol Sh3kbp1
Ensembl Gene ENSMUSG00000040990
Gene NameSH3-domain kinase binding protein 1
SynonymsIN85, 5830464D22Rik, 1700125L08Rik, Seta, Ruk, 1200007H22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6726 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location159627272-159978069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 159841180 bp
ZygosityHomozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 39 (E39D)
Ref Sequence ENSEMBL: ENSMUSP00000108072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073094] [ENSMUST00000080394] [ENSMUST00000112451] [ENSMUST00000112453] [ENSMUST00000112456] [ENSMUST00000123433] [ENSMUST00000141354]
PDB Structure
Solution structure of the SH3 domain of SH3-domain kinase binding protein 1 [SOLUTION NMR]
Solution structure of the third SH3 domain of SH3-domain kinase binding protein 1 (Regulator of ubiquitous kinase, Ruk) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000073094
SMART Domains Protein: ENSMUSP00000072840
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 2 57 2.69e-22 SMART
SH3 101 156 5.69e-21 SMART
low complexity region 221 239 N/A INTRINSIC
SH3 314 371 1.26e-22 SMART
low complexity region 381 387 N/A INTRINSIC
low complexity region 421 431 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 535 556 N/A INTRINSIC
low complexity region 600 623 N/A INTRINSIC
coiled coil region 647 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080394
SMART Domains Protein: ENSMUSP00000079257
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 64 119 5.69e-21 SMART
low complexity region 140 158 N/A INTRINSIC
SH3 233 290 1.26e-22 SMART
low complexity region 300 306 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
low complexity region 355 370 N/A INTRINSIC
low complexity region 454 475 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
coiled coil region 566 623 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112447
Predicted Effect probably benign
Transcript: ENSMUST00000112451
SMART Domains Protein: ENSMUSP00000108070
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 32 89 1.26e-22 SMART
low complexity region 99 105 N/A INTRINSIC
low complexity region 139 149 N/A INTRINSIC
low complexity region 154 169 N/A INTRINSIC
low complexity region 253 274 N/A INTRINSIC
low complexity region 318 341 N/A INTRINSIC
coiled coil region 365 422 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112453
AA Change: E39D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108072
Gene: ENSMUSG00000040990
AA Change: E39D

DomainStartEndE-ValueType
SH3 69 126 1.26e-22 SMART
low complexity region 136 142 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
low complexity region 290 311 N/A INTRINSIC
low complexity region 355 378 N/A INTRINSIC
coiled coil region 402 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112456
SMART Domains Protein: ENSMUSP00000108075
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 2 57 2.69e-22 SMART
SH3 101 156 5.69e-21 SMART
low complexity region 177 195 N/A INTRINSIC
SH3 270 327 1.26e-22 SMART
low complexity region 337 343 N/A INTRINSIC
low complexity region 377 387 N/A INTRINSIC
low complexity region 392 407 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 556 579 N/A INTRINSIC
coiled coil region 603 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123433
SMART Domains Protein: ENSMUSP00000114799
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 42 97 5.69e-21 SMART
low complexity region 118 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141354
SMART Domains Protein: ENSMUSP00000114262
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 64 119 5.69e-21 SMART
low complexity region 140 158 N/A INTRINSIC
SH3 233 290 1.26e-22 SMART
low complexity region 300 306 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
low complexity region 355 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150433
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that contains three N-terminal Src homology domains, a proline rich region and a C-terminal coiled-coil domain. The encoded protein facilitates protein-protein interactions and has been implicated in numerous cellular processes including apoptosis, cytoskeletal rearrangement, cell adhesion and in the regulation of clathrin-dependent endocytosis. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele have an increased lean body mass, increased dopamine in the striatum and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Sh3kbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02244:Sh3kbp1 APN X 159803728 missense probably damaging 1.00
R2145:Sh3kbp1 UTSW X 159824496 missense probably benign 0.09
R6728:Sh3kbp1 UTSW X 159841180 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGAGAGTAATTTAGATGGGCAGTC -3'
(R):5'- CAGACTTCTGCTTTTAGGAAGAC -3'

Sequencing Primer
(F):5'- AACTGTTACACCATGTCACAGAGATG -3'
(R):5'- GGACTCAGAGAAACATGAC -3'
Posted On2018-08-01