Mutagenetix > Incidental Mutation

Incidental Mutation 'R6728:Insrr'

529939

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

MMRRC Submission

044846-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.285) question?

Stock #

R6728 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87704258-87723408 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87720873 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1044 (R1044C)

Ref Sequence

ENSEMBL: ENSMUSP00000103208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

AlphaFold

Q9WTL4

Predicted Effect

probably damaging
Transcript: ENSMUST00000029711
AA Change: R1044C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: R1044C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107582
AA Change: R1044C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: R1044C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,384,645 (GRCm39)	Y440C	possibly damaging	Het
Acot11	C	T	4: 106,617,327 (GRCm39)	G240R	probably damaging	Het
Adcy5	T	A	16: 34,977,535 (GRCm39)	V356E	possibly damaging	Het
Agmat	G	T	4: 141,476,897 (GRCm39)	C101F	probably benign	Het
Aoc1l3	T	C	6: 48,965,779 (GRCm39)	S596P	possibly damaging	Het
Atl1	T	C	12: 69,994,324 (GRCm39)	V276A	possibly damaging	Het
Barhl1	G	A	2: 28,805,495 (GRCm39)	P66L	probably benign	Het
Camk4	A	T	18: 33,317,992 (GRCm39)	E383V	probably benign	Het
Cap2	G	A	13: 46,793,335 (GRCm39)	E234K	possibly damaging	Het
Col24a1	A	T	3: 145,020,957 (GRCm39)	M443L	probably benign	Het
Cyp17a1	A	G	19: 46,657,673 (GRCm39)	V293A	probably benign	Het
Epha6	C	A	16: 60,245,198 (GRCm39)	A334S	possibly damaging	Het
Frmpd1	T	C	4: 45,284,664 (GRCm39)	S1162P	probably benign	Het
Hspbp1	T	A	7: 4,663,781 (GRCm39)	M355L	possibly damaging	Het
Kin	G	A	2: 10,094,959 (GRCm39)	R82Q	possibly damaging	Het
Ninl	G	T	2: 150,817,777 (GRCm39)	S129*	probably null	Het
Or11h4	T	C	14: 50,974,296 (GRCm39)	T108A	possibly damaging	Het
Or4k35	A	T	2: 111,100,018 (GRCm39)	D231E	probably benign	Het
Paqr5	C	T	9: 61,871,065 (GRCm39)	R171Q	probably damaging	Het
Platr25	G	A	13: 62,848,197 (GRCm39)	H222Y	probably damaging	Het
Plcb2	G	T	2: 118,554,171 (GRCm39)	S94Y	probably damaging	Het
Rock2	T	C	12: 17,011,737 (GRCm39)	Y722H	probably benign	Het
Sh3kbp1	A	T	X: 158,624,176 (GRCm39)	E39D	probably benign	Homo
Thsd4	T	C	9: 59,904,480 (GRCm39)	D572G	probably benign	Het
Tnrc6b	T	A	15: 80,802,727 (GRCm39)	L1510H	probably damaging	Het
Tsc2	A	G	17: 24,840,098 (GRCm39)	S433P	probably damaging	Het
Vegfc	T	C	8: 54,639,057 (GRCm39)	V401A	probably damaging	Het
Vwa3b	A	G	1: 37,196,453 (GRCm39)	M27V	probably damaging	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87,720,981 (GRCm39)	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87,721,115 (GRCm39)	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87,708,099 (GRCm39)	nonsense	probably null
IGL01755:Insrr	APN	3	87,721,493 (GRCm39)	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87,718,927 (GRCm39)	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87,708,029 (GRCm39)	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87,717,216 (GRCm39)	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87,720,434 (GRCm39)	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87,716,719 (GRCm39)	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87,711,805 (GRCm39)	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87,721,124 (GRCm39)	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87,720,368 (GRCm39)	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87,716,879 (GRCm39)	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87,717,824 (GRCm39)	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87,721,498 (GRCm39)	nonsense	probably null
IGL03073:Insrr	APN	3	87,717,245 (GRCm39)	splice site	probably benign
IGL03178:Insrr	APN	3	87,709,848 (GRCm39)	splice site	probably null
IGL03389:Insrr	APN	3	87,716,038 (GRCm39)	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87,716,638 (GRCm39)	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87,720,888 (GRCm39)	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87,716,923 (GRCm39)	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87,707,759 (GRCm39)	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87,707,759 (GRCm39)	missense	probably damaging	1.00
R0357:Insrr	UTSW	3	87,715,953 (GRCm39)	splice site	probably null
R0501:Insrr	UTSW	3	87,717,991 (GRCm39)	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87,720,463 (GRCm39)	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87,708,179 (GRCm39)	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87,721,744 (GRCm39)	splice site	probably benign
R0558:Insrr	UTSW	3	87,718,288 (GRCm39)	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87,720,440 (GRCm39)	missense	probably damaging	0.97
R1312:Insrr	UTSW	3	87,707,797 (GRCm39)	missense	probably damaging	1.00
R1694:Insrr	UTSW	3	87,711,369 (GRCm39)	missense	probably benign
R1785:Insrr	UTSW	3	87,717,879 (GRCm39)	splice site	probably null
R1786:Insrr	UTSW	3	87,717,879 (GRCm39)	splice site	probably null
R1892:Insrr	UTSW	3	87,721,184 (GRCm39)	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87,721,820 (GRCm39)	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87,721,598 (GRCm39)	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87,710,488 (GRCm39)	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87,717,879 (GRCm39)	splice site	probably null
R2131:Insrr	UTSW	3	87,717,879 (GRCm39)	splice site	probably null
R2133:Insrr	UTSW	3	87,717,879 (GRCm39)	splice site	probably null
R2220:Insrr	UTSW	3	87,716,725 (GRCm39)	missense	probably damaging	1.00
R2259:Insrr	UTSW	3	87,707,759 (GRCm39)	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87,709,974 (GRCm39)	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87,716,906 (GRCm39)	missense	probably benign
R4042:Insrr	UTSW	3	87,721,134 (GRCm39)	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87,715,978 (GRCm39)	missense	possibly damaging	0.67
R4511:Insrr	UTSW	3	87,715,978 (GRCm39)	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87,708,194 (GRCm39)	missense	probably benign
R4870:Insrr	UTSW	3	87,718,911 (GRCm39)	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87,722,572 (GRCm39)	missense	probably benign	0.00
R5393:Insrr	UTSW	3	87,718,007 (GRCm39)	splice site	probably null
R5685:Insrr	UTSW	3	87,707,803 (GRCm39)	splice site	probably null
R6039:Insrr	UTSW	3	87,716,608 (GRCm39)	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87,716,608 (GRCm39)	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87,711,483 (GRCm39)	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87,707,826 (GRCm39)	nonsense	probably null
R6298:Insrr	UTSW	3	87,720,272 (GRCm39)	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87,720,873 (GRCm39)	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87,720,873 (GRCm39)	missense	probably damaging	1.00
R6796:Insrr	UTSW	3	87,720,873 (GRCm39)	missense	probably damaging	1.00
R7041:Insrr	UTSW	3	87,722,551 (GRCm39)	missense	probably damaging	1.00
R7169:Insrr	UTSW	3	87,715,901 (GRCm39)	missense	probably benign	0.15
R7270:Insrr	UTSW	3	87,710,440 (GRCm39)	missense	probably damaging	1.00
R7340:Insrr	UTSW	3	87,721,623 (GRCm39)	critical splice donor site	probably null
R7398:Insrr	UTSW	3	87,716,039 (GRCm39)	missense	probably damaging	1.00
R7473:Insrr	UTSW	3	87,711,838 (GRCm39)	splice site	probably null
R7815:Insrr	UTSW	3	87,716,002 (GRCm39)	missense	probably damaging	0.98
R8159:Insrr	UTSW	3	87,707,735 (GRCm39)	missense	probably damaging	1.00
R8289:Insrr	UTSW	3	87,721,501 (GRCm39)	missense	probably damaging	1.00
R8309:Insrr	UTSW	3	87,717,749 (GRCm39)	missense	probably benign	0.00
R8312:Insrr	UTSW	3	87,707,791 (GRCm39)	missense	possibly damaging	0.93
R8445:Insrr	UTSW	3	87,720,891 (GRCm39)	missense	probably damaging	1.00
R8917:Insrr	UTSW	3	87,718,276 (GRCm39)	missense	probably benign	0.00
R8960:Insrr	UTSW	3	87,720,386 (GRCm39)	missense	probably damaging	1.00
R8989:Insrr	UTSW	3	87,722,664 (GRCm39)	missense	probably damaging	0.96
R9015:Insrr	UTSW	3	87,720,910 (GRCm39)	missense	probably damaging	1.00
R9202:Insrr	UTSW	3	87,720,427 (GRCm39)	missense	probably damaging	1.00
R9251:Insrr	UTSW	3	87,717,391 (GRCm39)	missense	probably benign	0.08
R9327:Insrr	UTSW	3	87,721,604 (GRCm39)	missense	probably damaging	1.00
R9646:Insrr	UTSW	3	87,721,805 (GRCm39)	missense	probably damaging	1.00
RF022:Insrr	UTSW	3	87,711,792 (GRCm39)	missense	possibly damaging	0.51
Z1177:Insrr	UTSW	3	87,708,134 (GRCm39)	missense	possibly damaging	0.91
Z1192:Insrr	UTSW	3	87,709,886 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCACGTCATGATTATGGTG -3'
(R):5'- ATGTCACTGAGTGCAGGCTG -3'

Sequencing Primer
(F):5'- GCACGTCATGATTATGGTGATAATC -3'
(R):5'- GGTGAAGGACTTCCCCACAC -3'

Posted On

2018-08-01