Incidental Mutation 'R6728:Adcy5'
ID529956
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R6728 (G1)
Quality Score206.009
Status Not validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35157165 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 356 (V356E)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114913
AA Change: V356E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: V356E

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTATCATGGCCGTGCTCTG -3'
(R):5'- GCATGAAGCCTTGTCTCTCTGG -3'

Sequencing Primer
(F):5'- AACCGTGCAGCGTTCCAC -3'
(R):5'- GGTTACTTTTGACCACTTTTAACTGG -3'
Posted On2018-08-01