Incidental Mutation 'R6731:Fgg'
ID530053
Institutional Source Beutler Lab
Gene Symbol Fgg
Ensembl Gene ENSMUSG00000033860
Gene Namefibrinogen gamma chain
Synonymsgamma-fibrinogen, 3010002H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6731 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location83007724-83015049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83012901 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 329 (F329S)
Ref Sequence ENSEMBL: ENSMUSP00000141648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048486] [ENSMUST00000194175]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048486
AA Change: F329S

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037018
Gene: ENSMUSG00000033860
AA Change: F329S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193581
Predicted Effect probably damaging
Transcript: ENSMUST00000194175
AA Change: F329S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141648
Gene: ENSMUSG00000033860
AA Change: F329S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Mice lacking the encoded protein did not possess detectable amounts of plasma fibrinogen. Pregnant mice lacking the encoded protein die due to heavy bleeding during delivery. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. Alternate splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Pregnant homozygous null mice exhibit retarded embryo-placental development, spontaneous abortion, and maternal death through excessive uterine bleeding. Mutants expressing a truncated polypeptide show reduced platelet aggregation, increased bleeding time, and occasional fatal neonatal bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,066,226 V534A probably benign Het
Acta1 G A 8: 123,893,217 T128I probably damaging Het
Ahnak T A 19: 9,011,562 D3403E possibly damaging Het
Aldoc T A 11: 78,326,092 D319E probably benign Het
Ank3 T A 10: 70,014,028 D1108E possibly damaging Het
Ankrd7 G A 6: 18,866,654 G58S probably damaging Het
Ass1 A T 2: 31,514,784 Y359F probably damaging Het
B3gnt2 G T 11: 22,836,888 S100* probably null Het
Cd46 T C 1: 195,083,467 probably null Het
Chst5 G T 8: 111,890,044 R315S probably benign Het
Cps1 T C 1: 67,160,871 S393P probably damaging Het
Dis3l T C 9: 64,310,438 probably null Het
Hsp90b1 T C 10: 86,701,905 T179A probably benign Het
Kat2a A T 11: 100,708,273 M559K probably damaging Het
Klhl41 T C 2: 69,674,700 I449T probably damaging Het
Lama5 A T 2: 180,188,574 I1880N probably benign Het
Lcp1 A G 14: 75,206,189 D215G probably damaging Het
Lrch3 A G 16: 32,950,420 T131A probably damaging Het
Mroh6 T C 15: 75,888,492 T78A probably benign Het
Naa15 T G 3: 51,455,873 V326G probably damaging Het
Nalcn T A 14: 123,599,934 Q6L probably benign Het
Nipbl T A 15: 8,322,590 I1863L probably damaging Het
Os9 C T 10: 127,098,543 G408D probably benign Het
Pcbp2 T C 15: 102,488,790 S237P probably damaging Het
Pcdhb10 G A 18: 37,413,476 R535H probably benign Het
Pex5l A T 3: 32,958,798 I320K probably damaging Het
Pgm1 T C 5: 64,100,975 F101S probably benign Het
Poc1b T A 10: 99,152,871 D207E probably null Het
Pou6f1 T C 15: 100,579,883 I460V possibly damaging Het
Rnf17 A T 14: 56,524,350 Q1623H possibly damaging Het
Rnf219 C T 14: 104,479,474 V488I probably benign Het
Rpap1 T C 2: 119,778,296 N195S probably benign Het
Sacs C A 14: 61,180,700 probably null Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Sele C T 1: 164,053,673 L481F probably damaging Het
Stk32a A G 18: 43,305,078 Y214C probably damaging Het
Tex44 T A 1: 86,426,485 S39T probably benign Het
Tmem135 A T 7: 89,243,964 M140K possibly damaging Het
Tox2 A G 2: 163,320,377 Y354C probably damaging Het
Trim21 A T 7: 102,559,212 F433L probably damaging Het
Trim24 T C 6: 37,943,485 F406L probably damaging Het
Ubr1 G C 2: 120,955,640 H166Q probably null Het
Wnt16 T A 6: 22,297,892 Y252* probably null Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp141 T C 7: 42,489,500 D36G probably damaging Het
Zfp729a C T 13: 67,620,146 V655I probably benign Het
Zfp974 A T 7: 27,911,649 V217E possibly damaging Het
Other mutations in Fgg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Fgg APN 3 83014228 missense possibly damaging 0.67
IGL01713:Fgg APN 3 83008416 missense probably benign 0.20
IGL02288:Fgg APN 3 83008153 missense probably benign 0.11
IGL02994:Fgg APN 3 83008474 missense probably benign
PIT4519001:Fgg UTSW 3 83012939 missense probably damaging 1.00
R1251:Fgg UTSW 3 83012980 missense probably benign 0.03
R2137:Fgg UTSW 3 83008438 missense possibly damaging 0.78
R2400:Fgg UTSW 3 83008187 missense possibly damaging 0.94
R2436:Fgg UTSW 3 83014189 missense possibly damaging 0.94
R3429:Fgg UTSW 3 83012783 missense probably damaging 1.00
R4356:Fgg UTSW 3 83012943 missense probably damaging 1.00
R4612:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4613:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4828:Fgg UTSW 3 83008370 splice site probably benign
R4898:Fgg UTSW 3 83008540 missense probably benign 0.02
R4938:Fgg UTSW 3 83012868 missense probably benign 0.00
R4967:Fgg UTSW 3 83012765 missense probably benign 0.33
R5635:Fgg UTSW 3 83011423 missense probably benign 0.07
R5740:Fgg UTSW 3 83011525 missense probably benign 0.01
R6307:Fgg UTSW 3 83012976 missense probably damaging 0.98
R6936:Fgg UTSW 3 83008420 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGCCTTGTGACTTGAGATCC -3'
(R):5'- ATGCCAGTTGGATAATGAGTGG -3'

Sequencing Primer
(F):5'- GTGACTTGAGATCCTCCTTTCCAC -3'
(R):5'- CCAGTTGGATAATGAGTGGTATCC -3'
Posted On2018-08-01