Incidental Mutation 'R6732:4930402H24Rik'
List |< first << previous [record 60 of 9592] next >> last >|
ID530095
Institutional Source Beutler Lab
Gene Symbol 4930402H24Rik
Ensembl Gene ENSMUSG00000027309
Gene NameRIKEN cDNA 4930402H24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R6732 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130706200-130906406 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 130810820 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044766] [ENSMUST00000110243] [ENSMUST00000119422] [ENSMUST00000120316] [ENSMUST00000138990] [ENSMUST00000146975]
Predicted Effect probably null
Transcript: ENSMUST00000044766
SMART Domains Protein: ENSMUSP00000046992
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 463 473 N/A INTRINSIC
low complexity region 533 545 N/A INTRINSIC
coiled coil region 1143 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110243
SMART Domains Protein: ENSMUSP00000105872
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119422
SMART Domains Protein: ENSMUSP00000113481
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 332 342 N/A INTRINSIC
low complexity region 402 414 N/A INTRINSIC
coiled coil region 1012 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120316
SMART Domains Protein: ENSMUSP00000112540
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123049
Predicted Effect probably benign
Transcript: ENSMUST00000138990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144014
Predicted Effect probably benign
Transcript: ENSMUST00000146975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148924
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,286,846 I486T probably damaging Het
Abcc5 T C 16: 20,404,684 N158S probably benign Het
AI182371 G T 2: 35,084,705 probably benign Het
Ap1ar G A 3: 127,815,685 Q96* probably null Het
Cd101 C T 3: 101,008,199 S684N probably benign Het
Cdh16 T G 8: 104,618,533 I375L probably benign Het
Chchd6 A G 6: 89,574,454 V75A probably benign Het
Coro2a A T 4: 46,551,374 N110K probably damaging Het
Cyp2c69 A G 19: 39,881,499 V93A probably benign Het
Egln3 C T 12: 54,180,641 A235T probably benign Het
Fryl T C 5: 73,054,781 T2335A probably damaging Het
Fzd3 T C 14: 65,235,803 D172G probably benign Het
Galnt2 T A 8: 124,340,822 W447R probably damaging Het
Iqce A G 5: 140,675,235 L450P probably benign Het
Ly9 T C 1: 171,594,085 T533A possibly damaging Het
Map3k19 A C 1: 127,824,232 F257V probably benign Het
Mroh7 GTT GTTT 4: 106,680,713 probably null Het
Olfr202 A T 16: 59,283,951 V182E probably benign Het
Pcdhb11 A T 18: 37,422,144 I176F probably benign Het
Pigp A C 16: 94,365,441 L96R probably damaging Het
Pkd1 A G 17: 24,569,413 D715G probably damaging Het
Plxnd1 A C 6: 115,969,929 L828R possibly damaging Het
Pramef20 C T 4: 144,373,173 V341I probably benign Het
Psmd2 T A 16: 20,662,636 S814T probably benign Het
Pusl1 A G 4: 155,891,116 S87P probably benign Het
Rgs3 T A 4: 62,602,943 D34E probably benign Het
Rhof A G 5: 123,131,936 F53L probably damaging Het
Sik3 C A 9: 46,212,553 P1217T probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc14a2 A G 18: 78,192,174 Y263H probably damaging Het
Slc26a4 C T 12: 31,526,600 probably null Het
Smyd3 T G 1: 179,395,830 H178P probably benign Het
Thada T C 17: 84,454,414 probably null Het
Top1mt A C 15: 75,669,488 probably null Het
Trim17 A T 11: 58,971,025 probably null Het
Ttn A T 2: 76,940,051 F2599I possibly damaging Het
Tuba3a A T 6: 125,281,645 D127E probably benign Het
Ucp1 A G 8: 83,291,477 T68A probably benign Het
Vmn2r69 A G 7: 85,411,143 V411A probably benign Het
Vmn2r74 A T 7: 85,957,550 V196E probably damaging Het
Wdr59 T C 8: 111,501,052 Y131C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb21 G T 16: 97,951,082 S667Y probably damaging Het
Other mutations in 4930402H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:4930402H24Rik APN 2 130784457 missense probably benign 0.00
IGL01093:4930402H24Rik APN 2 130777236 missense probably benign 0.01
IGL01111:4930402H24Rik APN 2 130736598 missense possibly damaging 0.66
IGL01146:4930402H24Rik APN 2 130770671 critical splice donor site probably null
IGL01346:4930402H24Rik APN 2 130791846 splice site probably benign
IGL01548:4930402H24Rik APN 2 130814259 missense probably damaging 1.00
IGL02339:4930402H24Rik APN 2 130739465 missense probably damaging 0.97
IGL02637:4930402H24Rik APN 2 130814307 intron probably benign
IGL02926:4930402H24Rik APN 2 130712366 missense probably benign 0.00
IGL02978:4930402H24Rik APN 2 130727162 missense probably damaging 0.99
IGL03126:4930402H24Rik APN 2 130791995 splice site probably null
IGL03387:4930402H24Rik APN 2 130717280 missense probably damaging 1.00
FR4304:4930402H24Rik UTSW 2 130770748 small insertion probably benign
FR4342:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770745 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4737:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770739 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770753 small insertion probably benign
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0357:4930402H24Rik UTSW 2 130712946 splice site probably benign
R0379:4930402H24Rik UTSW 2 130785546 splice site probably benign
R0515:4930402H24Rik UTSW 2 130740488 missense probably damaging 1.00
R0576:4930402H24Rik UTSW 2 130713470 missense probably benign 0.16
R0811:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R0812:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R1334:4930402H24Rik UTSW 2 130775722 splice site probably null
R1485:4930402H24Rik UTSW 2 130748683 critical splice donor site probably null
R1486:4930402H24Rik UTSW 2 130737418 missense probably damaging 1.00
R1670:4930402H24Rik UTSW 2 130712379 missense probably damaging 1.00
R1678:4930402H24Rik UTSW 2 130814273 missense probably damaging 0.99
R1700:4930402H24Rik UTSW 2 130709938 missense probably damaging 0.99
R1742:4930402H24Rik UTSW 2 130740395 splice site probably null
R2046:4930402H24Rik UTSW 2 130810917 missense possibly damaging 0.61
R2374:4930402H24Rik UTSW 2 130820574 missense probably damaging 1.00
R3878:4930402H24Rik UTSW 2 130778503 missense possibly damaging 0.92
R3907:4930402H24Rik UTSW 2 130736576 missense probably damaging 0.99
R4467:4930402H24Rik UTSW 2 130767647 missense probably damaging 0.96
R4931:4930402H24Rik UTSW 2 130741873 missense possibly damaging 0.58
R5098:4930402H24Rik UTSW 2 130798181 missense probably damaging 0.99
R5191:4930402H24Rik UTSW 2 130737403 missense possibly damaging 0.68
R5313:4930402H24Rik UTSW 2 130709268 missense probably damaging 1.00
R5405:4930402H24Rik UTSW 2 130712460 missense probably damaging 1.00
R5436:4930402H24Rik UTSW 2 130764499 missense probably benign 0.16
R5522:4930402H24Rik UTSW 2 130814302 intron probably benign
R5783:4930402H24Rik UTSW 2 130739083 missense possibly damaging 0.59
R5931:4930402H24Rik UTSW 2 130814189 missense probably damaging 1.00
R6145:4930402H24Rik UTSW 2 130778473 missense probably benign
R6938:4930402H24Rik UTSW 2 130775753 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTCGCTCTCACCTATTAAC -3'
(R):5'- TGCGATTGGGTCCAACTGTC -3'

Sequencing Primer
(F):5'- CCTCTCTCAAAAGACATTTATTGGTC -3'
(R):5'- CCAACTGTCCGGGATGGTATTTG -3'
Posted On2018-08-01