Incidental Mutation 'R6732:Ucp1'
ID 530111
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Name uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms Slc25a7
MMRRC Submission 044850-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6732 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 84016981-84025081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84018106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 68 (T68A)
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
AlphaFold P12242
Predicted Effect probably benign
Transcript: ENSMUST00000034146
AA Change: T68A

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: T68A

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,117,190 (GRCm39) I486T probably damaging Het
Abcc5 T C 16: 20,223,434 (GRCm39) N158S probably benign Het
AI182371 G T 2: 34,974,717 (GRCm39) probably benign Het
Ap1ar G A 3: 127,609,334 (GRCm39) Q96* probably null Het
Cd101 C T 3: 100,915,515 (GRCm39) S684N probably benign Het
Cdh16 T G 8: 105,345,165 (GRCm39) I375L probably benign Het
Chchd6 A G 6: 89,551,436 (GRCm39) V75A probably benign Het
Coro2a A T 4: 46,551,374 (GRCm39) N110K probably damaging Het
Cyp2c69 A G 19: 39,869,943 (GRCm39) V93A probably benign Het
Dnaaf9 A G 2: 130,652,740 (GRCm39) probably null Het
Egln3 C T 12: 54,227,427 (GRCm39) A235T probably benign Het
Fryl T C 5: 73,212,124 (GRCm39) T2335A probably damaging Het
Fzd3 T C 14: 65,473,252 (GRCm39) D172G probably benign Het
Galnt2 T A 8: 125,067,561 (GRCm39) W447R probably damaging Het
Iqce A G 5: 140,660,990 (GRCm39) L450P probably benign Het
Ly9 T C 1: 171,421,653 (GRCm39) T533A possibly damaging Het
Map3k19 A C 1: 127,751,969 (GRCm39) F257V probably benign Het
Mroh7 GTT GTTT 4: 106,537,910 (GRCm39) probably null Het
Or5ac20 A T 16: 59,104,314 (GRCm39) V182E probably benign Het
Pcdhb11 A T 18: 37,555,197 (GRCm39) I176F probably benign Het
Pigp A C 16: 94,166,300 (GRCm39) L96R probably damaging Het
Pkd1 A G 17: 24,788,387 (GRCm39) D715G probably damaging Het
Plxnd1 A C 6: 115,946,890 (GRCm39) L828R possibly damaging Het
Pramel15 C T 4: 144,099,743 (GRCm39) V341I probably benign Het
Psmd2 T A 16: 20,481,386 (GRCm39) S814T probably benign Het
Pusl1 A G 4: 155,975,573 (GRCm39) S87P probably benign Het
Rgs3 T A 4: 62,521,180 (GRCm39) D34E probably benign Het
Rhof A G 5: 123,269,999 (GRCm39) F53L probably damaging Het
Sik3 C A 9: 46,123,851 (GRCm39) P1217T probably benign Het
Skic2 G A 17: 35,064,166 (GRCm39) R507* probably null Het
Slc14a2 A G 18: 78,235,389 (GRCm39) Y263H probably damaging Het
Slc26a4 C T 12: 31,576,599 (GRCm39) probably null Het
Smyd3 T G 1: 179,223,395 (GRCm39) H178P probably benign Het
Thada T C 17: 84,761,842 (GRCm39) probably null Het
Top1mt A C 15: 75,541,337 (GRCm39) probably null Het
Trim17 A T 11: 58,861,851 (GRCm39) probably null Het
Ttn A T 2: 76,770,395 (GRCm39) F2599I possibly damaging Het
Tuba3a A T 6: 125,258,608 (GRCm39) D127E probably benign Het
Vmn2r69 A G 7: 85,060,351 (GRCm39) V411A probably benign Het
Vmn2r74 A T 7: 85,606,758 (GRCm39) V196E probably damaging Het
Wdr59 T C 8: 112,227,684 (GRCm39) Y131C probably damaging Het
Yod1 G A 1: 130,645,275 (GRCm39) G19S probably damaging Het
Zbtb21 G T 16: 97,752,282 (GRCm39) S667Y probably damaging Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 84,020,577 (GRCm39) missense probably damaging 1.00
R0050:Ucp1 UTSW 8 84,020,857 (GRCm39) missense probably damaging 1.00
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0505:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 84,018,232 (GRCm39) splice site probably benign
R0681:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 84,024,476 (GRCm39) splice site probably benign
R1606:Ucp1 UTSW 8 84,021,933 (GRCm39) missense probably damaging 1.00
R1722:Ucp1 UTSW 8 84,017,317 (GRCm39) missense probably benign 0.25
R1809:Ucp1 UTSW 8 84,024,496 (GRCm39) missense probably damaging 0.99
R1823:Ucp1 UTSW 8 84,020,661 (GRCm39) missense probably damaging 1.00
R3809:Ucp1 UTSW 8 84,017,270 (GRCm39) missense probably damaging 0.99
R4085:Ucp1 UTSW 8 84,020,580 (GRCm39) missense probably benign 0.43
R4673:Ucp1 UTSW 8 84,021,876 (GRCm39) missense probably damaging 1.00
R4998:Ucp1 UTSW 8 84,024,484 (GRCm39) critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 84,020,832 (GRCm39) missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 84,017,320 (GRCm39) missense probably benign 0.12
R5790:Ucp1 UTSW 8 84,024,520 (GRCm39) missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 84,020,567 (GRCm39) missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 84,020,718 (GRCm39) critical splice donor site probably null
R7282:Ucp1 UTSW 8 84,020,531 (GRCm39) missense probably benign 0.03
R7343:Ucp1 UTSW 8 84,021,881 (GRCm39) missense probably damaging 0.99
R7878:Ucp1 UTSW 8 84,024,521 (GRCm39) missense probably benign 0.19
R8008:Ucp1 UTSW 8 84,020,640 (GRCm39) missense probably benign 0.32
R8365:Ucp1 UTSW 8 84,020,628 (GRCm39) missense probably damaging 0.97
R8899:Ucp1 UTSW 8 84,017,216 (GRCm39) missense probably benign 0.35
R9186:Ucp1 UTSW 8 84,017,272 (GRCm39) nonsense probably null
R9499:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9551:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9552:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCAAGCTCCACCTCTG -3'
(R):5'- TTTCCTCACTGGCCAGTTGG -3'

Sequencing Primer
(F):5'- CTCCACCTCTGAGATGGATAGATG -3'
(R):5'- CACTGGCCAGTTGGTTTTCACAG -3'
Posted On 2018-08-01