Incidental Mutation 'R6733:Ror1'
ID530133
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100426055 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 439 (V439A)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect probably benign
Transcript: ENSMUST00000039630
AA Change: V439A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: V439A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense not run
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACCTTCACAATGTCCAGCTG -3'
(R):5'- AGAGTTCCATGGTTCTCCTCTG -3'

Sequencing Primer
(F):5'- TGTCCAGCTGTGATTTTCAAAC -3'
(R):5'- GTGTTTGCTTTGAACTCTGCC -3'
Posted On2018-08-01