Incidental Mutation 'R6733:1600015I10Rik'
ID530137
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene NameRIKEN cDNA 1600015I10 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location48929895-48933687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48930530 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 155 (S155P)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
Predicted Effect probably damaging
Transcript: ENSMUST00000031837
AA Change: S155P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: S155P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158710
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CATAGAAATGCTGCTGCCCG -3'
(R):5'- GTTGCAACATGAACCAGCTAC -3'

Sequencing Primer
(F):5'- AATGCTGCTGCCCGATAAG -3'
(R):5'- CTACAGCGCTGGTCAGATTTTG -3'
Posted On2018-08-01