Incidental Mutation 'R6735:Adap1'
ID530178
Institutional Source Beutler Lab
Gene Symbol Adap1
Ensembl Gene ENSMUSG00000056413
Gene NameArfGAP with dual PH domains 1
Synonyms4930431P11Rik, Centa1, centaurin alpha 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6735 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location139271876-139325622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139293145 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 127 (Y127N)
Ref Sequence ENSEMBL: ENSMUSP00000106489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110865]
Predicted Effect probably damaging
Transcript: ENSMUST00000110865
AA Change: Y127N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106489
Gene: ENSMUSG00000056413
AA Change: Y127N

DomainStartEndE-ValueType
ArfGap 7 126 2.45e-60 SMART
PH 130 232 1.02e-5 SMART
PH 253 358 9.48e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196271
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,900 H230Q probably benign Het
2510039O18Rik A G 4: 147,941,817 T265A probably benign Het
Alg8 T C 7: 97,382,982 F246S probably benign Het
Alpk1 A G 3: 127,724,449 Y68H probably damaging Het
Arhgef5 T C 6: 43,275,032 S906P probably benign Het
C9 A T 15: 6,489,906 D408V probably benign Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Cpeb4 T A 11: 31,924,700 Y174N probably benign Het
Enpp3 A G 10: 24,807,453 Y289H probably damaging Het
Erbin A T 13: 103,884,210 D80E probably damaging Het
Fgd6 A T 10: 94,074,320 E829V possibly damaging Het
Foxn2 T G 17: 88,486,795 S387A probably benign Het
H2afy2 A G 10: 61,741,267 I274T probably damaging Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Lhx6 T G 2: 36,091,378 D67A probably damaging Het
Lmbr1l A T 15: 98,909,240 M220K probably damaging Het
Lrmp T C 6: 145,160,893 L201S probably damaging Het
Naa35 T C 13: 59,625,564 L111P probably damaging Het
Notch2 T A 3: 98,134,586 V1307E probably damaging Het
Nts T A 10: 102,484,998 M77L probably benign Het
Olfr1029 A C 2: 85,975,434 S64R possibly damaging Het
Pigz A G 16: 31,945,543 N473S probably benign Het
Pkd2 A G 5: 104,480,329 D423G probably damaging Het
Plac8 A G 5: 100,562,619 probably null Het
Ppp2r2b T C 18: 42,688,588 probably null Het
Proc T C 18: 32,123,648 N322S probably benign Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Psd3 A G 8: 68,120,746 probably null Het
Safb A G 17: 56,585,169 probably benign Het
Scnn1g A G 7: 121,742,263 D216G probably benign Het
Sept7 A G 9: 25,303,752 E345G possibly damaging Het
Sult2a5 A T 7: 13,665,058 K197* probably null Het
Suv39h1 C A X: 8,062,899 R397L probably damaging Homo
Thbs4 T A 13: 92,755,166 M814L possibly damaging Het
Tmem14a T A 1: 21,229,581 probably benign Het
Tmprss11d C A 5: 86,309,300 A167S probably damaging Het
Ttn C A 2: 76,798,908 C14362F probably damaging Het
Usp15 T C 10: 123,168,367 I161V possibly damaging Het
Vmn1r67 T C 7: 10,447,211 L134P probably damaging Het
Wdr74 A G 19: 8,736,222 E73G possibly damaging Het
Zbtb49 A T 5: 38,201,058 M617K possibly damaging Het
Zc3h3 G A 15: 75,756,634 T937I probably benign Het
Zeb2 C T 2: 45,110,016 V25M probably null Het
Zfp108 T C 7: 24,261,772 F596S probably damaging Het
Zfyve1 T A 12: 83,594,844 N13Y possibly damaging Het
Zswim2 T C 2: 83,923,761 D185G probably benign Het
Other mutations in Adap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02601:Adap1 APN 5 139307786 missense probably damaging 1.00
R0012:Adap1 UTSW 5 139307734 splice site probably benign
R0012:Adap1 UTSW 5 139307734 splice site probably benign
R0137:Adap1 UTSW 5 139293221 splice site probably benign
R1959:Adap1 UTSW 5 139273341 missense probably benign 0.01
R2913:Adap1 UTSW 5 139274821 splice site probably null
R2930:Adap1 UTSW 5 139307866 missense probably benign 0.00
R6154:Adap1 UTSW 5 139307776 missense possibly damaging 0.68
R6291:Adap1 UTSW 5 139273491 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAATCGTGAGCATCAGGC -3'
(R):5'- CCTGAATGTTGGTTATCAAGGG -3'

Sequencing Primer
(F):5'- GTCACTGAGCTGGCTGTCTC -3'
(R):5'- TTATCAAGGGTAGCTGGGACCAC -3'
Posted On2018-08-01