Incidental Mutation 'R6735:Scnn1g'
ID530185
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Namesodium channel, nonvoltage-gated 1 gamma
SynonymsENaC gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R6735 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121734479-121768475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121742263 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 216 (D216G)
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
Predicted Effect probably benign
Transcript: ENSMUST00000000221
AA Change: D216G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: D216G

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,900 H230Q probably benign Het
2510039O18Rik A G 4: 147,941,817 T265A probably benign Het
Adap1 A T 5: 139,293,145 Y127N probably damaging Het
Alg8 T C 7: 97,382,982 F246S probably benign Het
Alpk1 A G 3: 127,724,449 Y68H probably damaging Het
Arhgef5 T C 6: 43,275,032 S906P probably benign Het
C9 A T 15: 6,489,906 D408V probably benign Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Cpeb4 T A 11: 31,924,700 Y174N probably benign Het
Enpp3 A G 10: 24,807,453 Y289H probably damaging Het
Erbin A T 13: 103,884,210 D80E probably damaging Het
Fgd6 A T 10: 94,074,320 E829V possibly damaging Het
Foxn2 T G 17: 88,486,795 S387A probably benign Het
H2afy2 A G 10: 61,741,267 I274T probably damaging Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Lhx6 T G 2: 36,091,378 D67A probably damaging Het
Lmbr1l A T 15: 98,909,240 M220K probably damaging Het
Lrmp T C 6: 145,160,893 L201S probably damaging Het
Naa35 T C 13: 59,625,564 L111P probably damaging Het
Notch2 T A 3: 98,134,586 V1307E probably damaging Het
Nts T A 10: 102,484,998 M77L probably benign Het
Olfr1029 A C 2: 85,975,434 S64R possibly damaging Het
Pigz A G 16: 31,945,543 N473S probably benign Het
Pkd2 A G 5: 104,480,329 D423G probably damaging Het
Plac8 A G 5: 100,562,619 probably null Het
Ppp2r2b T C 18: 42,688,588 probably null Het
Proc T C 18: 32,123,648 N322S probably benign Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Psd3 A G 8: 68,120,746 probably null Het
Safb A G 17: 56,585,169 probably benign Het
Sept7 A G 9: 25,303,752 E345G possibly damaging Het
Sult2a5 A T 7: 13,665,058 K197* probably null Het
Suv39h1 C A X: 8,062,899 R397L probably damaging Homo
Thbs4 T A 13: 92,755,166 M814L possibly damaging Het
Tmem14a T A 1: 21,229,581 probably benign Het
Tmprss11d C A 5: 86,309,300 A167S probably damaging Het
Ttn C A 2: 76,798,908 C14362F probably damaging Het
Usp15 T C 10: 123,168,367 I161V possibly damaging Het
Vmn1r67 T C 7: 10,447,211 L134P probably damaging Het
Wdr74 A G 19: 8,736,222 E73G possibly damaging Het
Zbtb49 A T 5: 38,201,058 M617K possibly damaging Het
Zc3h3 G A 15: 75,756,634 T937I probably benign Het
Zeb2 C T 2: 45,110,016 V25M probably null Het
Zfp108 T C 7: 24,261,772 F596S probably damaging Het
Zfyve1 T A 12: 83,594,844 N13Y possibly damaging Het
Zswim2 T C 2: 83,923,761 D185G probably benign Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121740437 missense probably benign 0.00
IGL01824:Scnn1g APN 7 121766293 missense probably benign 0.00
IGL02133:Scnn1g APN 7 121743699 missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121742446 splice site probably benign
IGL02814:Scnn1g APN 7 121740365 missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121746683 missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121737933 nonsense probably null
PIT4504001:Scnn1g UTSW 7 121742331 missense probably benign 0.30
R0230:Scnn1g UTSW 7 121746761 splice site probably benign
R0324:Scnn1g UTSW 7 121740555 missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121746579 splice site probably benign
R0534:Scnn1g UTSW 7 121767424 missense probably benign 0.00
R1747:Scnn1g UTSW 7 121760463 missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121738188 nonsense probably null
R2197:Scnn1g UTSW 7 121767296 missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121740427 missense probably benign 0.01
R4804:Scnn1g UTSW 7 121763080 frame shift probably null
R4805:Scnn1g UTSW 7 121746602 missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121766266 missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121738215 missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121767358 missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121738095 missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121767499 missense probably benign 0.00
R6666:Scnn1g UTSW 7 121767388 missense probably benign 0.00
R6813:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121760444 missense probably benign 0.01
R7289:Scnn1g UTSW 7 121738081 nonsense probably null
R7488:Scnn1g UTSW 7 121763434 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGACCTCAATGTCCGAC -3'
(R):5'- AGTCCTTAGAGAGTGTCCCTTCC -3'

Sequencing Primer
(F):5'- GACCTCAATGTCCGACTTTGC -3'
(R):5'- AGAGAGTGTCCCTTCCTGACCTG -3'
Posted On2018-08-01