Incidental Mutation 'R6737:Tnik'
ID530221
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28596086 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 449 (K449N)
Ref Sequence ENSEMBL: ENSMUSP00000124681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: K449N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: K449N

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: K449N
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: K449N

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: K478N
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: K478N

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: K478N
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: K478N

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: K449N
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: K449N

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect unknown
Transcript: ENSMUST00000161964
AA Change: K449N
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: K449N

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: K478N
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: K478N

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162777
AA Change: K478N
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: K478N

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTACAGTTCTCCAAGGACATG -3'
(R):5'- ACACAGCAAGTCTTCTGTCC -3'

Sequencing Primer
(F):5'- AAGTAATGTTCTGTAGGGAATGCC -3'
(R):5'- ACACAGCAAGTCTTCTGTCCTTACC -3'
Posted On2018-08-01