Incidental Mutation 'R6737:Fndc7'
ID530223
Institutional Source Beutler Lab
Gene Symbol Fndc7
Ensembl Gene ENSMUSG00000045326
Gene Namefibronectin type III domain containing 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location108853678-108890008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108872278 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 317 (V317L)
Ref Sequence ENSEMBL: ENSMUSP00000136215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053065] [ENSMUST00000102620] [ENSMUST00000180063]
Predicted Effect probably damaging
Transcript: ENSMUST00000053065
AA Change: V231L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051172
Gene: ENSMUSG00000045326
AA Change: V231L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
Blast:FN3 201 274 9e-44 BLAST
FN3 283 360 1.07e-1 SMART
FN3 457 530 5.1e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102620
AA Change: V317L

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099680
Gene: ENSMUSG00000045326
AA Change: V317L

DomainStartEndE-ValueType
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 1e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139137
SMART Domains Protein: ENSMUSP00000117562
Gene: ENSMUSG00000045326

DomainStartEndE-ValueType
Blast:FN3 1 123 3e-27 BLAST
SCOP:d1f6fb2 3 64 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147002
Predicted Effect probably damaging
Transcript: ENSMUST00000180063
AA Change: V317L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136215
Gene: ENSMUSG00000045326
AA Change: V317L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 2e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Fndc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02077:Fndc7 APN 3 108883468 missense probably benign 0.17
IGL02823:Fndc7 APN 3 108869171 missense probably damaging 1.00
IGL02896:Fndc7 APN 3 108862931 missense probably benign 0.04
IGL03196:Fndc7 APN 3 108883444 missense probably damaging 1.00
IGL03343:Fndc7 APN 3 108867308 missense probably damaging 1.00
IGL03377:Fndc7 APN 3 108876532 missense probably benign 0.12
R0240:Fndc7 UTSW 3 108858919 splice site probably benign
R0324:Fndc7 UTSW 3 108876699 splice site probably null
R0457:Fndc7 UTSW 3 108876545 missense probably benign 0.02
R0630:Fndc7 UTSW 3 108876615 missense probably damaging 1.00
R0891:Fndc7 UTSW 3 108870588 missense possibly damaging 0.54
R1752:Fndc7 UTSW 3 108869330 missense probably benign 0.14
R1772:Fndc7 UTSW 3 108870534 missense probably damaging 1.00
R1923:Fndc7 UTSW 3 108876687 missense probably benign 0.00
R1957:Fndc7 UTSW 3 108883509 missense probably damaging 0.98
R3801:Fndc7 UTSW 3 108869148 missense possibly damaging 0.95
R4592:Fndc7 UTSW 3 108858902 missense probably damaging 1.00
R4650:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4652:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4791:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R4933:Fndc7 UTSW 3 108876670 missense probably benign 0.01
R5004:Fndc7 UTSW 3 108883473 missense probably damaging 1.00
R5042:Fndc7 UTSW 3 108862786 missense probably damaging 1.00
R5054:Fndc7 UTSW 3 108881347 missense probably damaging 0.97
R5175:Fndc7 UTSW 3 108869166 missense probably benign 0.04
R5325:Fndc7 UTSW 3 108883449 missense probably damaging 1.00
R5571:Fndc7 UTSW 3 108856408 missense possibly damaging 0.68
R5638:Fndc7 UTSW 3 108862892 missense possibly damaging 0.69
R5846:Fndc7 UTSW 3 108881391 missense probably damaging 1.00
R6488:Fndc7 UTSW 3 108870575 missense probably damaging 0.99
R6993:Fndc7 UTSW 3 108876591 missense probably benign 0.00
R6998:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R6999:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7000:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7001:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7181:Fndc7 UTSW 3 108881324 critical splice donor site probably null
R7324:Fndc7 UTSW 3 108872221 missense probably benign 0.06
R7425:Fndc7 UTSW 3 108876659 missense probably benign 0.00
Z1088:Fndc7 UTSW 3 108883500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTTAACGGGCATCAAAG -3'
(R):5'- AACTCAGAGTTGTTGATTTGCG -3'

Sequencing Primer
(F):5'- CGGGCATCAAAGATGACTTACCTG -3'
(R):5'- CATCTAAGATAGCTGCCGAGATGC -3'
Posted On2018-08-01