Incidental Mutation 'R6737:Rnf19b'
ID530225
Institutional Source Beutler Lab
Gene Symbol Rnf19b
Ensembl Gene ENSMUSG00000028793
Gene Namering finger protein 19B
Synonyms4930555L03Rik, Ibrdc3, 4930534K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location129058271-129085886 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 129085551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030584] [ENSMUST00000097874] [ENSMUST00000168461]
Predicted Effect probably benign
Transcript: ENSMUST00000030584
SMART Domains Protein: ENSMUSP00000030584
Gene: ENSMUSG00000028793

DomainStartEndE-ValueType
low complexity region 52 115 N/A INTRINSIC
RING 116 163 4.84e-3 SMART
IBR 183 248 5.61e-24 SMART
IBR 251 330 6.35e-2 SMART
transmembrane domain 356 378 N/A INTRINSIC
transmembrane domain 399 421 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 616 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097874
SMART Domains Protein: ENSMUSP00000095484
Gene: ENSMUSG00000028793

DomainStartEndE-ValueType
IBR 2 67 5.61e-24 SMART
IBR 70 149 6.35e-2 SMART
transmembrane domain 175 197 N/A INTRINSIC
transmembrane domain 218 240 N/A INTRINSIC
low complexity region 330 353 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130803
AA Change: V160A
SMART Domains Protein: ENSMUSP00000121004
Gene: ENSMUSG00000028793
AA Change: V160A

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147238
Predicted Effect probably benign
Transcript: ENSMUST00000168461
SMART Domains Protein: ENSMUSP00000131373
Gene: ENSMUSG00000028793

DomainStartEndE-ValueType
low complexity region 52 115 N/A INTRINSIC
RING 116 163 4.84e-3 SMART
IBR 183 248 5.61e-24 SMART
IBR 251 329 4.95e-2 SMART
transmembrane domain 355 377 N/A INTRINSIC
transmembrane domain 398 420 N/A INTRINSIC
low complexity region 510 533 N/A INTRINSIC
low complexity region 615 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein containing two RING-type and one IBR-type zinc finger motifs. The encoded protin is an E3 ubiquitin-protein ligase that plays a role in the cytotoxic effects of natural killer (NK) cells. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes X and Y in a possible pseudoautosomal region. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired NK cell cytolysis and an impaired ability to control introduced tumor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Rnf19b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Rnf19b APN 4 129071789 missense probably damaging 1.00
IGL01478:Rnf19b APN 4 129058830 missense probably damaging 1.00
IGL01511:Rnf19b APN 4 129080418 missense probably damaging 1.00
IGL02052:Rnf19b APN 4 129071820 missense probably damaging 1.00
IGL02576:Rnf19b APN 4 129073522 nonsense probably null
IGL03140:Rnf19b APN 4 129084096 missense probably benign 0.01
PIT4519001:Rnf19b UTSW 4 129075653 missense probably damaging 1.00
R0632:Rnf19b UTSW 4 129073551 missense probably damaging 1.00
R1187:Rnf19b UTSW 4 129075567 splice site probably null
R1500:Rnf19b UTSW 4 129078961 missense probably damaging 1.00
R4560:Rnf19b UTSW 4 129071823 missense probably damaging 1.00
R5185:Rnf19b UTSW 4 129083920 nonsense probably null
R5726:Rnf19b UTSW 4 129071892 missense possibly damaging 0.83
R5805:Rnf19b UTSW 4 129058824 missense probably damaging 1.00
R6941:Rnf19b UTSW 4 129082779 missense probably benign 0.01
R7235:Rnf19b UTSW 4 129083778 missense
Predicted Primers PCR Primer
(F):5'- TGAAAGCTCATACAAAGAACTGCAG -3'
(R):5'- CCAACAGGTTCCTTTAGTCGC -3'

Sequencing Primer
(F):5'- CTGCAGAGCAAGAGATTCAATGTC -3'
(R):5'- TTTAGTCGCACCGGGACATC -3'
Posted On2018-08-01