Incidental Mutation 'R6737:Sh3bp2'
ID530227
Institutional Source Beutler Lab
Gene Symbol Sh3bp2
Ensembl Gene ENSMUSG00000054520
Gene NameSH3-domain binding protein 2
Synonyms3BP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6737 (G1)
Quality Score131.008
Status Not validated
Chromosome5
Chromosomal Location34525838-34563641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34562474 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 609 (Y609C)
Ref Sequence ENSEMBL: ENSMUSP00000112554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067638] [ENSMUST00000101316] [ENSMUST00000118545] [ENSMUST00000179943]
Predicted Effect probably damaging
Transcript: ENSMUST00000067638
AA Change: Y553C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070890
Gene: ENSMUSG00000054520
AA Change: Y553C

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101316
AA Change: Y597C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098874
Gene: ENSMUSG00000054520
AA Change: Y597C

DomainStartEndE-ValueType
PH 71 176 1.33e-18 SMART
low complexity region 185 195 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 244 260 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
low complexity region 414 429 N/A INTRINSIC
SH2 497 586 2.04e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118545
AA Change: Y609C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112554
Gene: ENSMUSG00000054520
AA Change: Y609C

DomainStartEndE-ValueType
PH 83 188 1.33e-18 SMART
low complexity region 197 207 N/A INTRINSIC
low complexity region 226 241 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
SH2 509 598 2.04e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153750
Predicted Effect probably damaging
Transcript: ENSMUST00000179943
AA Change: Y553C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136671
Gene: ENSMUSG00000054520
AA Change: Y553C

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has an N-terminal pleckstrin homology (PH) domain, an SH3-binding proline-rich region, and a C-terminal SH2 domain. The protein binds to the SH3 domains of several proteins including the ABL1 and SYK protein tyrosine kinases , and functions as a cytoplasmic adaptor protein to positively regulate transcriptional activity in T, natural killer (NK), and basophilic cells. Mutations in this gene result in cherubism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Nullizygous mutations may lead to higher pre-B cell numbers and impaired B cell receptor signaling or thymus-independent type 2 humoral responses. Homozygosity for a knock-in allele causes premature death, enhanced osteoclast differentiation and TNF production, systemic bone loss and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Sh3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Sh3bp2 APN 5 34556003 missense probably damaging 0.99
IGL02478:Sh3bp2 APN 5 34551662 missense probably damaging 1.00
IGL03196:Sh3bp2 APN 5 34557343 missense probably damaging 1.00
IGL03329:Sh3bp2 APN 5 34559202 missense probably benign 0.00
R0718:Sh3bp2 UTSW 5 34555495 missense probably damaging 0.99
R1322:Sh3bp2 UTSW 5 34555493 missense probably damaging 1.00
R1501:Sh3bp2 UTSW 5 34555576 critical splice donor site probably null
R1573:Sh3bp2 UTSW 5 34560690 missense probably benign 0.01
R1649:Sh3bp2 UTSW 5 34559004 missense possibly damaging 0.61
R1939:Sh3bp2 UTSW 5 34551619 missense probably damaging 1.00
R2021:Sh3bp2 UTSW 5 34544225 critical splice acceptor site probably benign
R2372:Sh3bp2 UTSW 5 34559496 missense probably benign 0.00
R2903:Sh3bp2 UTSW 5 34543556 nonsense probably null
R3709:Sh3bp2 UTSW 5 34551658 missense probably damaging 1.00
R4344:Sh3bp2 UTSW 5 34555542 missense possibly damaging 0.86
R4391:Sh3bp2 UTSW 5 34549718 missense probably benign
R5068:Sh3bp2 UTSW 5 34556967 missense probably benign 0.00
R5637:Sh3bp2 UTSW 5 34561048 missense possibly damaging 0.69
R5658:Sh3bp2 UTSW 5 34556947 missense probably damaging 1.00
R6005:Sh3bp2 UTSW 5 34562465 missense possibly damaging 0.65
R6014:Sh3bp2 UTSW 5 34559627 missense probably benign 0.00
R6391:Sh3bp2 UTSW 5 34561603 missense probably damaging 1.00
R7144:Sh3bp2 UTSW 5 34561631 missense probably benign 0.00
R7536:Sh3bp2 UTSW 5 34543557 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGGCAGTGGGTTACTCAGTC -3'
(R):5'- CAGACCTGGGTTCTTGAGAG -3'

Sequencing Primer
(F):5'- AGTGGGTTACTCAGTCCCTGC -3'
(R):5'- TGGATGGGCCAAGTCATCCAG -3'
Posted On2018-08-01