Incidental Mutation 'R6737:Slc28a1'
ID530238
Institutional Source Beutler Lab
Gene Symbol Slc28a1
Ensembl Gene ENSMUSG00000025726
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 1
SynonymsCnt1
MMRRC Submission
Accession Numbers

Genbank: NM_001004184; MGI: 3605073

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location81114799-81170416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 81169248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 615 (V615G)
Ref Sequence ENSEMBL: ENSMUSP00000112421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026820] [ENSMUST00000119083]
Predicted Effect probably benign
Transcript: ENSMUST00000026820
AA Change: V615G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026820
Gene: ENSMUSG00000025726
AA Change: V615G

DomainStartEndE-ValueType
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 109 128 N/A INTRINSIC
transmembrane domain 149 168 N/A INTRINSIC
Pfam:Nucleos_tra2_N 183 257 1e-24 PFAM
Pfam:Gate 263 392 5.5e-10 PFAM
Pfam:Nucleos_tra2_C 366 591 4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119083
AA Change: V615G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112421
Gene: ENSMUSG00000025726
AA Change: V615G

DomainStartEndE-ValueType
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 109 128 N/A INTRINSIC
transmembrane domain 149 168 N/A INTRINSIC
Pfam:Nucleos_tra2_N 183 256 4.8e-27 PFAM
Pfam:Gate 263 364 1.1e-9 PFAM
Pfam:Nucleos_tra2_C 366 590 9.2e-76 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI

All alleles(30) : Gene trapped(30)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Slc28a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Slc28a1 APN 7 81169068 splice site probably benign
IGL01386:Slc28a1 APN 7 81164679 missense probably benign 0.01
IGL02586:Slc28a1 APN 7 81164419 missense probably benign 0.04
IGL02695:Slc28a1 APN 7 81167991 missense probably benign 0.00
IGL02836:Slc28a1 APN 7 81126161 missense probably damaging 1.00
7510:Slc28a1 UTSW 7 81169269 missense probably benign
R0206:Slc28a1 UTSW 7 81117706 splice site probably benign
R0208:Slc28a1 UTSW 7 81117706 splice site probably benign
R0379:Slc28a1 UTSW 7 81138177 missense probably benign
R0733:Slc28a1 UTSW 7 81124900 missense probably benign 0.37
R1435:Slc28a1 UTSW 7 81153517 missense probably damaging 1.00
R1827:Slc28a1 UTSW 7 81138202 missense possibly damaging 0.85
R1909:Slc28a1 UTSW 7 81142035 missense probably damaging 1.00
R1917:Slc28a1 UTSW 7 81169586 missense probably benign 0.00
R2147:Slc28a1 UTSW 7 81126267 missense possibly damaging 0.94
R3804:Slc28a1 UTSW 7 81126221 missense probably damaging 1.00
R4004:Slc28a1 UTSW 7 81169038 missense probably damaging 1.00
R4967:Slc28a1 UTSW 7 81142009 missense possibly damaging 0.91
R5055:Slc28a1 UTSW 7 81169048 missense possibly damaging 0.77
R5256:Slc28a1 UTSW 7 81122121 missense probably damaging 0.98
R5494:Slc28a1 UTSW 7 81168039 missense probably damaging 1.00
R5924:Slc28a1 UTSW 7 81115612 missense probably benign 0.26
R6062:Slc28a1 UTSW 7 81115563 nonsense probably null
R6229:Slc28a1 UTSW 7 81125005 missense probably benign 0.00
X0020:Slc28a1 UTSW 7 81124963 missense possibly damaging 0.85
Z1088:Slc28a1 UTSW 7 81138168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAATTCCGACCCCTTG -3'
(R):5'- AAGCAGTACACTATCCAGGC -3'

Sequencing Primer
(F):5'- AGAATTCCGACCCCTTGCTTTCTAC -3'
(R):5'- TGGGAAAGTCACTCCACATCTCTAG -3'
Posted On2018-08-01