Incidental Mutation 'R6737:Olfr628'
ID530239
Institutional Source Beutler Lab
Gene Symbol Olfr628
Ensembl Gene ENSMUSG00000096516
Gene Nameolfactory receptor 628
SynonymsGA_x6K02T2PBJ9-6457667-6458617, MOR22-4P, MOR22-4P, Olfr1526-ps1, MOR22-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103730374-103733324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103732150 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 75 (L75F)
Ref Sequence ENSEMBL: ENSMUSP00000151622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098193] [ENSMUST00000218266]
Predicted Effect probably damaging
Transcript: ENSMUST00000098193
AA Change: L75F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095795
Gene: ENSMUSG00000096516
AA Change: L75F

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 2.3e-106 PFAM
Pfam:7tm_1 43 295 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218266
AA Change: L75F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Olfr628
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Olfr628 APN 7 103732480 missense possibly damaging 0.47
IGL02121:Olfr628 APN 7 103732469 missense probably damaging 1.00
R0140:Olfr628 UTSW 7 103732142 missense probably damaging 1.00
R0505:Olfr628 UTSW 7 103732376 missense probably benign 0.09
R0582:Olfr628 UTSW 7 103732673 missense possibly damaging 0.82
R1585:Olfr628 UTSW 7 103732378 missense possibly damaging 0.56
R1907:Olfr628 UTSW 7 103731983 missense probably damaging 1.00
R4766:Olfr628 UTSW 7 103732250 missense possibly damaging 0.70
R4954:Olfr628 UTSW 7 103732207 missense probably damaging 1.00
R5464:Olfr628 UTSW 7 103732189 missense probably damaging 1.00
R6761:Olfr628 UTSW 7 103732484 missense probably damaging 1.00
R6782:Olfr628 UTSW 7 103732342 missense possibly damaging 0.67
R7015:Olfr628 UTSW 7 103732817 missense probably null 0.85
X0058:Olfr628 UTSW 7 103732282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTCAGGCCTTCAGTGC -3'
(R):5'- CGCTGGGTAAAGATGGATGC -3'

Sequencing Primer
(F):5'- GCTGACTCTGACTGGGATTCC -3'
(R):5'- GCATGTCTTAGAGGATAACAGATTGC -3'
Posted On2018-08-01