Incidental Mutation 'R6737:Ctnnd2'
ID530271
Institutional Source Beutler Lab
Gene Symbol Ctnnd2
Ensembl Gene ENSMUSG00000022240
Gene Namecatenin (cadherin associated protein), delta 2
SynonymsCatnd2, neurojugin, Nprap
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_008729.2; MGI:1195966

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location30172593-31029341 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 30966834 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 952 (S952*)
Ref Sequence ENSEMBL: ENSMUSP00000154410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081728] [ENSMUST00000226119]
Predicted Effect probably null
Transcript: ENSMUST00000081728
AA Change: S977*
SMART Domains Protein: ENSMUSP00000080427
Gene: ENSMUSG00000022240
AA Change: S977*

DomainStartEndE-ValueType
coiled coil region 50 84 N/A INTRINSIC
low complexity region 87 97 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
ARM 577 617 1.85e-8 SMART
ARM 621 662 1.15e-9 SMART
ARM 663 720 1.51e1 SMART
ARM 722 769 2.74e1 SMART
ARM 830 871 4.88e0 SMART
ARM 902 942 2.76e-7 SMART
low complexity region 964 973 N/A INTRINSIC
ARM 995 1039 5.64e-4 SMART
low complexity region 1086 1099 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000226119
AA Change: S952*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228332
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype Strain: 3056606
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesive junction associated protein of the armadillo/beta-catenin superfamily and is implicated in brain and eye development and cancer formation. The protein encoded by this gene promotes the disruption of E-cadherin based adherens junction to favor cell spreading upon stimulation by hepatocyte growth factor. This gene is overexpressed in prostate adenocarcinomas and is associated with decreased expression of tumor suppressor E-cadherin in this tissue. This gene resides in a region of the short arm of chromosome 5 that is deleted in Cri du Chat syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal conditioning, spatial learning and coordination behaviors and abnormal long term potentiation. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Ctnnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Ctnnd2 APN 15 30647141 missense possibly damaging 0.73
IGL01612:Ctnnd2 APN 15 31005018 missense probably damaging 1.00
IGL01923:Ctnnd2 APN 15 30480828 missense probably damaging 0.99
IGL02183:Ctnnd2 APN 15 31020740 missense probably damaging 1.00
IGL02186:Ctnnd2 APN 15 30480793 missense probably damaging 0.99
IGL02226:Ctnnd2 APN 15 30847336 missense probably benign 0.01
IGL02307:Ctnnd2 APN 15 30647211 missense possibly damaging 0.86
IGL02407:Ctnnd2 APN 15 30966768 missense probably damaging 1.00
IGL02474:Ctnnd2 APN 15 30669562 missense possibly damaging 0.71
IGL02718:Ctnnd2 APN 15 31027616 missense probably damaging 1.00
IGL03249:Ctnnd2 APN 15 30683236 missense probably benign 0.45
IGL03328:Ctnnd2 APN 15 30921847 splice site probably benign
carpe UTSW 15 30905820 missense probably damaging 1.00
diem UTSW 15 30683347 missense possibly damaging 0.85
P0016:Ctnnd2 UTSW 15 30966938 missense probably benign 0.00
R0130:Ctnnd2 UTSW 15 30921913 missense probably damaging 1.00
R0408:Ctnnd2 UTSW 15 30634677 missense probably damaging 1.00
R0611:Ctnnd2 UTSW 15 31009084 missense possibly damaging 0.75
R0894:Ctnnd2 UTSW 15 30332155 splice site probably benign
R1112:Ctnnd2 UTSW 15 30921880 missense probably damaging 1.00
R1459:Ctnnd2 UTSW 15 30847299 missense probably damaging 1.00
R1529:Ctnnd2 UTSW 15 30887121 missense possibly damaging 0.91
R1532:Ctnnd2 UTSW 15 30921868 missense probably damaging 1.00
R1701:Ctnnd2 UTSW 15 30921981 missense probably damaging 1.00
R1807:Ctnnd2 UTSW 15 30619871 missense probably damaging 1.00
R1881:Ctnnd2 UTSW 15 31005081 splice site probably benign
R1960:Ctnnd2 UTSW 15 30647111 missense probably damaging 0.96
R2121:Ctnnd2 UTSW 15 30669514 missense probably damaging 1.00
R3839:Ctnnd2 UTSW 15 31009028 splice site probably null
R3967:Ctnnd2 UTSW 15 30646929 missense possibly damaging 0.81
R3980:Ctnnd2 UTSW 15 30669443 missense probably benign 0.14
R4207:Ctnnd2 UTSW 15 30972827 missense probably damaging 0.99
R4279:Ctnnd2 UTSW 15 30905820 missense probably damaging 1.00
R4498:Ctnnd2 UTSW 15 30619874 missense probably damaging 1.00
R4622:Ctnnd2 UTSW 15 30887169 missense probably benign 0.17
R4622:Ctnnd2 UTSW 15 31009113 missense probably benign 0.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4979:Ctnnd2 UTSW 15 31009075 missense probably damaging 1.00
R5086:Ctnnd2 UTSW 15 30683347 missense possibly damaging 0.85
R5330:Ctnnd2 UTSW 15 30332115 missense probably damaging 1.00
R5459:Ctnnd2 UTSW 15 30887188 missense probably damaging 1.00
R5595:Ctnnd2 UTSW 15 30669543 missense probably benign 0.07
R5809:Ctnnd2 UTSW 15 30847377 missense probably damaging 1.00
R5987:Ctnnd2 UTSW 15 30683241 missense probably benign
R6245:Ctnnd2 UTSW 15 30905748 missense probably damaging 1.00
R6379:Ctnnd2 UTSW 15 30634698 missense probably damaging 1.00
R6979:Ctnnd2 UTSW 15 30619230 missense probably damaging 0.99
R7133:Ctnnd2 UTSW 15 30480849 missense possibly damaging 0.47
R7179:Ctnnd2 UTSW 15 30683364 missense possibly damaging 0.95
R7267:Ctnnd2 UTSW 15 30683355 missense probably benign 0.13
R7275:Ctnnd2 UTSW 15 30905709 missense possibly damaging 0.94
R7386:Ctnnd2 UTSW 15 30966768 missense probably damaging 1.00
Z1088:Ctnnd2 UTSW 15 30966813 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCATCCAGTGTCTGCATGC -3'
(R):5'- TGTTGGCACTGACTTACTCC -3'

Sequencing Primer
(F):5'- AGTGTCTGCATGCATCCTC -3'
(R):5'- GTTGGCACTGACTTACTCCAATAC -3'
Posted On2018-08-01