Incidental Mutation 'R6737:Smc1b'
ID530273
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Namestructural maintenance of chromosomes 1B
SynonymsSMC1beta, Smc1l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85064689-85131964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85092031 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 825 (R825Q)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]
Predicted Effect probably benign
Transcript: ENSMUST00000023068
AA Change: R825Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: R825Q

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85129700 missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85131898 missense probably damaging 1.00
IGL01656:Smc1b APN 15 85114776 missense probably damaging 0.99
IGL01807:Smc1b APN 15 85096745 missense probably damaging 0.97
IGL02094:Smc1b APN 15 85097891 splice site probably benign
IGL02121:Smc1b APN 15 85097985 missense probably benign
IGL02631:Smc1b APN 15 85107003 missense probably damaging 0.98
IGL02678:Smc1b APN 15 85065000 nonsense probably null
IGL03197:Smc1b APN 15 85070863 missense possibly damaging 0.85
IGL03214:Smc1b APN 15 85097946 nonsense probably null
IGL03218:Smc1b APN 15 85089713 missense probably benign 0.07
IGL03232:Smc1b APN 15 85129720 missense possibly damaging 0.68
adamantine UTSW 15 85121641 missense probably benign 0.06
unbreakable UTSW 15 85096658 missense probably benign
E0370:Smc1b UTSW 15 85127581 missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 85069651 missense possibly damaging 0.91
R0092:Smc1b UTSW 15 85067724 unclassified probably benign
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0207:Smc1b UTSW 15 85123759 missense probably benign
R0390:Smc1b UTSW 15 85066277 missense probably damaging 1.00
R0440:Smc1b UTSW 15 85112673 splice site probably benign
R0685:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R1109:Smc1b UTSW 15 85112815 missense probably damaging 0.98
R1392:Smc1b UTSW 15 85107070 splice site probably benign
R1509:Smc1b UTSW 15 85086134 missense probably benign
R1804:Smc1b UTSW 15 85127790 missense possibly damaging 0.90
R1879:Smc1b UTSW 15 85092067 missense probably benign 0.01
R2086:Smc1b UTSW 15 85121851 splice site probably benign
R2143:Smc1b UTSW 15 85123802 missense probably benign
R2158:Smc1b UTSW 15 85121851 splice site probably benign
R2174:Smc1b UTSW 15 85121851 splice site probably benign
R2471:Smc1b UTSW 15 85092017 missense probably damaging 0.98
R3689:Smc1b UTSW 15 85117263 intron probably benign
R3690:Smc1b UTSW 15 85117263 intron probably benign
R4178:Smc1b UTSW 15 85120647 missense possibly damaging 0.94
R4420:Smc1b UTSW 15 85112830 missense probably damaging 1.00
R4905:Smc1b UTSW 15 85066227 missense probably damaging 1.00
R4919:Smc1b UTSW 15 85117104 intron probably benign
R5114:Smc1b UTSW 15 85064984 missense probably damaging 1.00
R5314:Smc1b UTSW 15 85070865 missense probably benign 0.00
R5476:Smc1b UTSW 15 85086151 missense probably damaging 0.97
R5593:Smc1b UTSW 15 85121641 missense probably benign 0.06
R5690:Smc1b UTSW 15 85112773 missense probably damaging 1.00
R5719:Smc1b UTSW 15 85096658 missense probably benign
R5817:Smc1b UTSW 15 85067783 missense probably damaging 0.99
R5834:Smc1b UTSW 15 85089665 missense probably damaging 1.00
R5930:Smc1b UTSW 15 85086121 missense probably damaging 1.00
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85121695 missense probably damaging 1.00
R6306:Smc1b UTSW 15 85127623 missense probably benign 0.30
R6392:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6426:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6435:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6436:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6437:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6508:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6512:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6703:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6775:Smc1b UTSW 15 85089680 missense probably damaging 0.96
R6889:Smc1b UTSW 15 85067759 missense probably damaging 1.00
R6908:Smc1b UTSW 15 85107010 missense probably damaging 1.00
R7124:Smc1b UTSW 15 85071597 missense probably damaging 0.98
R7400:Smc1b UTSW 15 85069720 missense probably damaging 1.00
R7417:Smc1b UTSW 15 85097542 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGATCACAATAAGGCACCATTGG -3'
(R):5'- GGCAATGGCAGTGATTATATTAAGG -3'

Sequencing Primer
(F):5'- GGCACTTCAGCTACTGAT -3'
(R):5'- CAGAGAACACTTACTGCTCTTGGAG -3'
Posted On2018-08-01