Incidental Mutation 'R6737:Fpr-rs6'
ID530278
Institutional Source Beutler Lab
Gene Symbol Fpr-rs6
Ensembl Gene ENSMUSG00000071275
Gene Nameformyl peptide receptor, related sequence 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20182078-20183097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20183077 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 7 (I7M)
Ref Sequence ENSEMBL: ENSMUSP00000093296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095636]
Predicted Effect probably benign
Transcript: ENSMUST00000095636
AA Change: I7M

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093296
Gene: ENSMUSG00000071275
AA Change: I7M

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 5.7e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Fpr-rs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Fpr-rs6 APN 17 20183045 missense probably benign 0.30
IGL03380:Fpr-rs6 APN 17 20182983 missense possibly damaging 0.66
R0149:Fpr-rs6 UTSW 17 20182213 missense probably benign 0.29
R0190:Fpr-rs6 UTSW 17 20182479 missense probably benign 0.07
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1934:Fpr-rs6 UTSW 17 20182890 missense probably benign 0.36
R1965:Fpr-rs6 UTSW 17 20182656 missense probably damaging 0.98
R3690:Fpr-rs6 UTSW 17 20182875 missense probably benign 0.02
R3963:Fpr-rs6 UTSW 17 20182217 missense probably damaging 1.00
R4564:Fpr-rs6 UTSW 17 20182906 nonsense probably null
R4574:Fpr-rs6 UTSW 17 20183097 start codon destroyed probably damaging 1.00
R5015:Fpr-rs6 UTSW 17 20182346 missense probably damaging 1.00
R5599:Fpr-rs6 UTSW 17 20182113 missense probably benign 0.05
R6786:Fpr-rs6 UTSW 17 20182838 missense possibly damaging 0.95
R6908:Fpr-rs6 UTSW 17 20182439 missense probably damaging 1.00
R7040:Fpr-rs6 UTSW 17 20182934 missense probably damaging 1.00
R7462:Fpr-rs6 UTSW 17 20182223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGATTGTTGTCACAGTGTG -3'
(R):5'- TTCAAGGTCATGGGAGATTATGAGTC -3'

Sequencing Primer
(F):5'- ACAGTGTGTGTCATCCGGAAC -3'
(R):5'- GTCATGGGAGATTATGAGTCATTTC -3'
Posted On2018-08-01