Incidental Mutation 'R6737:Syt7'
ID530282
Institutional Source Beutler Lab
Gene Symbol Syt7
Ensembl Gene ENSMUSG00000024743
Gene Namesynaptotagmin VII
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location10389090-10453181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10444044 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 531 (V531M)
Ref Sequence ENSEMBL: ENSMUSP00000076234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073899] [ENSMUST00000076968] [ENSMUST00000169121] [ENSMUST00000223586] [ENSMUST00000224135]
Predicted Effect probably damaging
Transcript: ENSMUST00000073899
AA Change: V323M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073560
Gene: ENSMUSG00000024743
AA Change: V323M

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 151 254 3.29e-25 SMART
low complexity region 261 274 N/A INTRINSIC
C2 282 396 4.98e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076968
AA Change: V531M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076234
Gene: ENSMUSG00000024743
AA Change: V531M

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 195 298 3.29e-25 SMART
low complexity region 305 318 N/A INTRINSIC
C2 326 440 4.98e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169121
AA Change: V487M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127973
Gene: ENSMUSG00000024743
AA Change: V487M

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
low complexity region 104 121 N/A INTRINSIC
C2 315 418 3.29e-25 SMART
low complexity region 425 438 N/A INTRINSIC
C2 446 560 4.98e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223586
AA Change: V367M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000224135
AA Change: V438M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225861
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have no gross abnormalities or obvious neurological defects. They do develop fibrosis in the skin and skeletal muscle over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Syt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Syt7 APN 19 10443391 missense probably benign 0.03
R0412:Syt7 UTSW 19 10444080 nonsense probably null
R1068:Syt7 UTSW 19 10444011 missense probably benign 0.01
R1793:Syt7 UTSW 19 10443990 missense probably damaging 1.00
R1955:Syt7 UTSW 19 10418038 missense probably damaging 1.00
R2049:Syt7 UTSW 19 10439213 missense probably benign 0.28
R2170:Syt7 UTSW 19 10439380 missense probably damaging 1.00
R2911:Syt7 UTSW 19 10443435 missense probably benign 0.00
R3694:Syt7 UTSW 19 10435636 missense possibly damaging 0.69
R4330:Syt7 UTSW 19 10421798 missense probably damaging 1.00
R4573:Syt7 UTSW 19 10439212 nonsense probably null
R4691:Syt7 UTSW 19 10426481 missense probably damaging 0.98
R4732:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4733:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4811:Syt7 UTSW 19 10435567 missense probably damaging 0.98
R5067:Syt7 UTSW 19 10442858 missense possibly damaging 0.58
R5069:Syt7 UTSW 19 10439237 missense probably benign 0.00
R5071:Syt7 UTSW 19 10443428 missense possibly damaging 0.92
R5372:Syt7 UTSW 19 10426621 missense probably damaging 1.00
R5830:Syt7 UTSW 19 10421787 missense probably damaging 1.00
R5979:Syt7 UTSW 19 10443479 missense probably damaging 1.00
R6833:Syt7 UTSW 19 10444144 missense probably damaging 1.00
R6843:Syt7 UTSW 19 10421771 missense probably damaging 1.00
R7010:Syt7 UTSW 19 10417990 missense probably benign 0.16
R7078:Syt7 UTSW 19 10435599 missense probably benign 0.14
R7206:Syt7 UTSW 19 10417973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGCTCCCACTTAGGTG -3'
(R):5'- CGGGAACTCAGAAAACCTTTGG -3'

Sequencing Primer
(F):5'- TGCACCTGGAAGGGCATG -3'
(R):5'- GAAAACCTTTGGGGAATTACCTCC -3'
Posted On2018-08-01