Incidental Mutation 'R6691:Ugt1a7c'
ID530401
Institutional Source Beutler Lab
Gene Symbol Ugt1a7c
Ensembl Gene ENSMUSG00000090124
Gene NameUDP glucuronosyltransferase 1 family, polypeptide A7C
SynonymsA10'
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location88095062-88220002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88095656 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 179 (E179G)
Ref Sequence ENSEMBL: ENSMUSP00000058683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058237
AA Change: E179G

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124
AA Change: E179G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121495
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Ugt1a7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Ugt1a7c APN 1 88095245 missense probably damaging 0.97
IGL01973:Ugt1a7c APN 1 88095134 missense probably benign 0.00
IGL01990:Ugt1a7c APN 1 88095602 missense probably damaging 1.00
IGL02589:Ugt1a7c APN 1 88095638 missense probably benign 0.00
IGL02625:Ugt1a7c APN 1 88095517 missense possibly damaging 0.94
IGL03381:Ugt1a7c APN 1 88095790 missense probably benign 0.00
R1205:Ugt1a7c UTSW 1 88095956 missense probably benign 0.00
R1667:Ugt1a7c UTSW 1 88095935 missense probably damaging 0.97
R1706:Ugt1a7c UTSW 1 88095725 missense probably damaging 0.99
R1928:Ugt1a7c UTSW 1 88095929 missense probably benign 0.35
R3809:Ugt1a7c UTSW 1 88095382 missense possibly damaging 0.95
R4194:Ugt1a7c UTSW 1 88095727 missense possibly damaging 0.67
R4787:Ugt1a7c UTSW 1 88095670 missense probably damaging 0.99
R5291:Ugt1a7c UTSW 1 88095509 missense possibly damaging 0.48
R5473:Ugt1a7c UTSW 1 88095437 missense probably benign 0.21
R5871:Ugt1a7c UTSW 1 88095659 missense possibly damaging 0.50
R5934:Ugt1a7c UTSW 1 88095879 missense probably damaging 0.99
R6591:Ugt1a7c UTSW 1 88095656 missense possibly damaging 0.85
R7033:Ugt1a7c UTSW 1 88095528 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCTCCAGCCAAAGGTTTCTTCG -3'
(R):5'- GGTCTGTCATAGTCACTGGG -3'

Sequencing Primer
(F):5'- CCAGCCAAAGGTTTCTTCGAATTAC -3'
(R):5'- CACTGGGGTCTGGAGAACTTCAG -3'
Posted On2018-08-01