Incidental Mutation 'R6691:Dusp11'
ID530412
Institutional Source Beutler Lab
Gene Symbol Dusp11
Ensembl Gene ENSMUSG00000030002
Gene Namedual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6691 (G1)
Quality Score143.008
Status Not validated
Chromosome6
Chromosomal Location85942268-85961667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85961525 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 4 (H4R)
Ref Sequence ENSEMBL: ENSMUSP00000032071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032071
AA Change: H4R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032071
Gene: ENSMUSG00000030002
AA Change: H4R

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
Pfam:DSPc 74 203 2.5e-18 PFAM
low complexity region 230 243 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151394
Predicted Effect probably benign
Transcript: ENSMUST00000201530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202379
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is localized to the nucleus and binds directly to RNA and splicing factors, and thus it is suggested to participate in nuclear mRNA metabolism. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Dusp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Dusp11 APN 6 85952370 splice site probably benign
IGL01584:Dusp11 APN 6 85953394 missense probably damaging 1.00
IGL02276:Dusp11 APN 6 85958617 missense probably damaging 1.00
IGL02727:Dusp11 APN 6 85961492 missense probably damaging 1.00
R0372:Dusp11 UTSW 6 85958730 splice site probably benign
R0413:Dusp11 UTSW 6 85952370 splice site probably benign
R1669:Dusp11 UTSW 6 85950026 missense probably benign 0.05
R2115:Dusp11 UTSW 6 85958669 missense probably damaging 1.00
R4610:Dusp11 UTSW 6 85950055 missense probably damaging 1.00
R4678:Dusp11 UTSW 6 85953381 missense probably damaging 0.98
R5288:Dusp11 UTSW 6 85947605 makesense probably null
R5386:Dusp11 UTSW 6 85947605 makesense probably null
R5756:Dusp11 UTSW 6 85952357 missense probably damaging 1.00
R5987:Dusp11 UTSW 6 85959233 nonsense probably null
R6591:Dusp11 UTSW 6 85961525 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAAGGGACGCCTCAATACAG -3'
(R):5'- ACTTTCAGTGCGACGTGTGTC -3'

Sequencing Primer
(F):5'- TCAATACAGGCAGCCGCG -3'
(R):5'- GTGTGTCGTCAGCACGG -3'
Posted On2018-08-01