Incidental Mutation 'R6691:Ube2m'
ID530413
Institutional Source Beutler Lab
Gene Symbol Ube2m
Ensembl Gene ENSMUSG00000005575
Gene Nameubiquitin-conjugating enzyme E2M
SynonymsUbc-rs2, UBC12, 2510040H03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location13035120-13038275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13036469 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 70 (F70I)
Ref Sequence ENSEMBL: ENSMUSP00000005714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005711] [ENSMUST00000005714] [ENSMUST00000125964] [ENSMUST00000165394] [ENSMUST00000210587] [ENSMUST00000211344] [ENSMUST00000211369] [ENSMUST00000211626]
Predicted Effect probably benign
Transcript: ENSMUST00000005711
SMART Domains Protein: ENSMUSP00000005711
Gene: ENSMUSG00000033916

DomainStartEndE-ValueType
Pfam:Snf7 17 187 9.5e-50 PFAM
coiled coil region 196 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000005714
AA Change: F70I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005714
Gene: ENSMUSG00000005575
AA Change: F70I

DomainStartEndE-ValueType
UBCc 32 173 8.83e-38 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123541
AA Change: F29I
SMART Domains Protein: ENSMUSP00000120234
Gene: ENSMUSG00000005575
AA Change: F29I

DomainStartEndE-ValueType
UBCc 1 162 2.43e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125964
AA Change: F58I

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122638
Gene: ENSMUSG00000005575
AA Change: F58I

DomainStartEndE-ValueType
UBCc 20 161 3.67e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156389
SMART Domains Protein: ENSMUSP00000117123
Gene: ENSMUSG00000005575

DomainStartEndE-ValueType
PDB:2NVU|C 69 138 4e-38 PDB
SCOP:d2e2c__ 83 136 2e-8 SMART
Blast:UBCc 92 138 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165394
SMART Domains Protein: ENSMUSP00000132604
Gene: ENSMUSG00000005575

DomainStartEndE-ValueType
UBCc 2 76 4.51e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209487
Predicted Effect probably benign
Transcript: ENSMUST00000210587
Predicted Effect probably benign
Transcript: ENSMUST00000211344
Predicted Effect probably benign
Transcript: ENSMUST00000211369
Predicted Effect probably benign
Transcript: ENSMUST00000211626
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is linked with a ubiquitin-like protein, NEDD8, which can be conjugated to cellular proteins, such as Cdc53/culin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Ube2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03100:Ube2m APN 7 13037635 missense probably benign 0.37
IGL03304:Ube2m APN 7 13035758 unclassified probably benign
R0077:Ube2m UTSW 7 13035730 missense probably damaging 1.00
R0715:Ube2m UTSW 7 13037626 missense probably benign 0.01
R0733:Ube2m UTSW 7 13035752 missense probably damaging 0.98
R1460:Ube2m UTSW 7 13035835 unclassified probably benign
R5207:Ube2m UTSW 7 13036322 unclassified probably null
R5228:Ube2m UTSW 7 13035770 unclassified probably benign
R6226:Ube2m UTSW 7 13035888 missense probably damaging 1.00
R6299:Ube2m UTSW 7 13035870 missense probably damaging 1.00
R6591:Ube2m UTSW 7 13036469 missense probably damaging 0.99
R6594:Ube2m UTSW 7 13037690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTCAATGTTGGGATGATAAACC -3'
(R):5'- TGCCCAAGACGTGTGACATC -3'

Sequencing Primer
(F):5'- GTTTCACACTTCACCTTGGGAG -3'
(R):5'- AGACGTGTGACATCAGCTTC -3'
Posted On2018-08-01