Incidental Mutation 'R6691:Ceacam12'
ID530414
Institutional Source Beutler Lab
Gene Symbol Ceacam12
Ensembl Gene ENSMUSG00000030366
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 12
SynonymsCeacam12-C1, Ceacam12-C3, 1600031J20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18065929-18077986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18069224 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 185 (V185D)
Ref Sequence ENSEMBL: ENSMUSP00000104123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032520] [ENSMUST00000108483] [ENSMUST00000108487]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032520
AA Change: V185D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032520
Gene: ENSMUSG00000030366
AA Change: V185D

DomainStartEndE-ValueType
IG 40 141 7.77e-1 SMART
IG_like 159 260 4.78e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108483
AA Change: V185D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104123
Gene: ENSMUSG00000030366
AA Change: V185D

DomainStartEndE-ValueType
IG 40 141 7.77e-1 SMART
IG_like 159 260 4.78e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108487
AA Change: V185D

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104127
Gene: ENSMUSG00000030366
AA Change: V185D

DomainStartEndE-ValueType
IG 40 141 7.77e-1 SMART
IG_like 159 260 4.78e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205637
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Ceacam12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Ceacam12 APN 7 18067261 missense probably damaging 1.00
IGL01483:Ceacam12 APN 7 18067521 missense probably benign 0.07
IGL01505:Ceacam12 APN 7 18067432 missense probably damaging 0.98
IGL01540:Ceacam12 APN 7 18071802 intron probably benign
R0033:Ceacam12 UTSW 7 18069460 splice site probably benign
R0033:Ceacam12 UTSW 7 18069460 splice site probably benign
R1816:Ceacam12 UTSW 7 18071765 synonymous probably null
R4227:Ceacam12 UTSW 7 18071753 missense probably benign 0.01
R4382:Ceacam12 UTSW 7 18066034 start gained probably benign
R4541:Ceacam12 UTSW 7 18071723 missense probably benign
R4651:Ceacam12 UTSW 7 18067434 missense probably damaging 1.00
R4652:Ceacam12 UTSW 7 18067434 missense probably damaging 1.00
R4831:Ceacam12 UTSW 7 18077380 splice site probably null
R5351:Ceacam12 UTSW 7 18067234 missense probably damaging 1.00
R5357:Ceacam12 UTSW 7 18077459 nonsense probably null
R5779:Ceacam12 UTSW 7 18069154 missense probably benign 0.29
R5893:Ceacam12 UTSW 7 18069374 missense probably damaging 1.00
R5946:Ceacam12 UTSW 7 18069206 missense probably damaging 1.00
R6151:Ceacam12 UTSW 7 18069105 missense probably benign 0.01
R6175:Ceacam12 UTSW 7 18067387 missense probably damaging 1.00
R6346:Ceacam12 UTSW 7 18069401 missense probably damaging 0.99
R6491:Ceacam12 UTSW 7 18069260 missense probably damaging 1.00
R6591:Ceacam12 UTSW 7 18069224 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GATGGACACAGCTGCTAAGAAC -3'
(R):5'- GTAGGCTGTAAAGTCCTGTGTC -3'

Sequencing Primer
(F):5'- TGCTAAGAACACAGAGACCCTTCTTC -3'
(R):5'- CTTCCTGTGAGACCTTCGAGAG -3'
Posted On2018-08-01