Incidental Mutation 'R6691:Cd209c'
ID530417
Institutional Source Beutler Lab
Gene Symbol Cd209c
Ensembl Gene ENSMUSG00000040165
Gene NameCD209c antigen
SynonymsSIGNR2, mSIGNR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3940222-3954746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3945680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 41 (I41L)
Ref Sequence ENSEMBL: ENSMUSP00000147005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044060] [ENSMUST00000208622]
Predicted Effect probably benign
Transcript: ENSMUST00000044060
AA Change: I41L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039861
Gene: ENSMUSG00000040165
AA Change: I41L

DomainStartEndE-ValueType
CLECT 48 169 7.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127592
SMART Domains Protein: ENSMUSP00000120433
Gene: ENSMUSG00000040165

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153915
Predicted Effect probably benign
Transcript: ENSMUST00000208622
AA Change: I41L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208902
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Cd209c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cd209c APN 8 3940339 missense probably damaging 1.00
IGL01340:Cd209c APN 8 3945892 missense probably benign 0.00
IGL02682:Cd209c APN 8 3940324 missense probably damaging 0.99
R1311:Cd209c UTSW 8 3945908 start codon destroyed probably benign
R1859:Cd209c UTSW 8 3944953 missense probably benign
R4374:Cd209c UTSW 8 3954635 exon noncoding transcript
R4375:Cd209c UTSW 8 3954635 exon noncoding transcript
R4377:Cd209c UTSW 8 3954635 exon noncoding transcript
R4769:Cd209c UTSW 8 3944953 missense probably benign
R4786:Cd209c UTSW 8 3945698 missense possibly damaging 0.77
R4841:Cd209c UTSW 8 3945905 missense probably benign 0.00
R4842:Cd209c UTSW 8 3945905 missense probably benign 0.00
R4869:Cd209c UTSW 8 3944077 missense probably benign 0.00
R5333:Cd209c UTSW 8 3944976 missense probably damaging 1.00
R5835:Cd209c UTSW 8 3945699 missense probably benign 0.01
R6369:Cd209c UTSW 8 3944984 missense probably damaging 1.00
R6497:Cd209c UTSW 8 3944122 missense possibly damaging 0.72
R6591:Cd209c UTSW 8 3945680 missense probably benign 0.14
R7181:Cd209c UTSW 8 3945712 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACTTCTGGTGGCTCAACC -3'
(R):5'- TTCTTTAATGCCCCTGGTGG -3'

Sequencing Primer
(F):5'- GTGTAGTTATGCCCATGCCATAGC -3'
(R):5'- CTTTAATGCCCCTGGTGGACAAG -3'
Posted On2018-08-01